Молекулярная биология

Раздел о совокупности биологических наук, изучающих механизмы хранения, передачи и реализации генетической информации, строение и функции нерегулярных биополимеров (белков и нуклеиновых кислот).

Геномы

В этом разделе описываются генетические характеристики различных живых организмов.

Общие сведения

С парадокс - длина геномов не зависит от сложности организма.
Сравнительные размеры геномов в разных группах организмов.

Размеры геномов и количество генов [Alberts,2002]

Объект размер генома, пн
Микоплазмы 104-106
Эубактерии (E.coli) 105-107
Грибы (2-5)x107
Вид Число генов Длина генома, пн
Eubacteria    
Mycoplasma genitalium 477 580.070
Synechocystis sp. 3168 3573 тыс.
E.coli 4280 4.639.221
Helicobacter pylori 1590 1667 тыс
Bacillus subtilis 4099 4214 тыс
Aquifex aelolicus 1544 1551 тыс
Micobacterium tuberculosis 4402 4447 тыс
Treponema pallidum 1041 1138 тыс
Rickettsia prowazekii 834 1111 тыс
Thermotoga maritima 1877 1860 тыс
Archaea    
Methanococcus sannaschii 1750 1664 тыс
Archaeoglobus fulgidus 2493 2178 тыс
Aeropyrum pernix 2620 669 тыс
Eucaryotes    
Saccharomyces cerevisiae ~6300 12.069 тыс
Arabidopsis thaliana ~26000 142.000 тыс
Caenorhabditis elegans ~19000 97.000 тыс
Drosophila melanogaster ~14000 137.000 тыс
X.laevis    
Homo sapiens ~30000 3.200.000 тыс
Водоросли (5-7)x10 Черви ~108 Моллюски 5x108-5x109 Насекомые 108-5x109 Ракообразные ~109 Иглокожие 2x108-2x109  Рыбы 3x108-1010 Амфибии 7x108-7x1010 Рептилии (2-3)109 Птицы 109  Млекопитающие 3x109 Цветковые растения 2x108-1011

Геном эукариот

Геном человека

У человека 23 пары хромосом, 22 аутосомы и 1 пара половых XX (женский пол) или XY (мужской пол).
Гаплоидный геном человека включает более 3 биллионов пар оснований ДНК, общей длинной приблизительно 1,8 м. Полный объем информации записанной в ДНК человека занимает около 750 мегабайт.
Гаплоидный геном человека содержит около 20,000–25,000 генов кодирующих белки.
Около 1.5% генома белок кодирующая, в то время как остальная ДНК включает регуляторные последовательности, интроны, РНК кодирующие последовательности, различные повторы и т.д.
~8% генома приходится на инактивированные последовательности некогда функционировавших ретровирусов HERV (Human endogenous retrovirus), самым молодым из которых, HERV-K, около 5-ти миллионов лет.
Французские исследователи восстановили последовательность одного из ретровирусов семейства HERV-K, содержащиеся в геноме. В клетках линии 239Т происходила транскрипция вирусной ДНК и продукция вирусных частиц. Более того, сам вирус, получивший название Phoenix, оказался способным самостоятельно осуществлять полный ретровирусный цикл от заражения клетки до интеграции в геном и сборки вирусных частиц. В некоторых опухолях, таких как тератокарцинома и меланома, экспрессируются отдельные белки HERV. Этого не достаточно для сборки полноценного вируса - слишком много мутаций. Однако, "воскрешение" полноценного вируса вполне может произойти за счет спонтанной рекомбинации - принципиальная возможность этого подтверждается результатами французских ученых.

Хромосома Генов Длина, пн Секвенировано
1 3,148 247,200,000 224,999,719
2 902 242,750,000 237,712,649
3 1,436 199,450,000 194,704,827
4 453 191,260,000 187,297,063
5 609 180,840,000 177,702,766
6 1,585 170,900,000 167,273,992
7 1,824 158,820,000 154,952,424
8 781 146,270,000 142,612,826
9 1,229 140,440,000 120,312,298
10 1,312 135,370,000 131,624,737
11 405 134,450,000 131,130,853
12 1,330 132,290,000 130,303,534
13 623 114,130,000 95,559,980
14 886 106,360,000 88,290,585
15 676 100,340,000 81,341,915
16 898 88,820,000 78,884,754
17 1,367 78,650,000 77,800,220
18 365 76,120,000 74,656,155
19 1,553 63,810,000 55,785,651
20 816 62,440,000 59,505,254
21 446 46,940,000 34,171,998
22 595 49,530,000 34,893,953
X 1,093 154,910,000 151,058,754
Y 125 57,740,000 22,429,293

Геном шимпанзе

Геном дрозофилы

Геном нематоды

Геном прокариот

К сожалению здесь ещё ничего не написано. Возможно, информации недостаточно или она недостоверна. Но вы можете помочь развитию проекта, а если вы уже зарегистрированы то можете внести свой вклад в наполнение сайта

Геном митохондрий

ДНК в митохондриях представлена циклическими молекулами, не образующими связь с гистонами, в этом отношении они напоминают бактериальные хромосомы.
У человека митохондриальная ДНК содержит 16,5 тыс. н.п., она полностью расшифрована. Найдено, что митохондральная ДНК различных объектов очень однородна, отличие их заключается лишь в величине интронов и нетранскрибируемых участков. Все митохондриальные ДНК представлены множественными копиями, собранными в группы, кластеры. Так в одной митохондрии печени крысы может содержаться от 1 до 50 циклических молекул ДНК. Общее же количество митохондриальной ДНК на клетку составляет около одного процента. Синтез митохондриальных ДНК не связан с синтезом ДНК в ядре. Так же как и у бактерий митохондральная ДНК собрана в отдельную зону – нуклеоид, его размер составляет около 0, 4 мкм в диаметре. В длинных митохондриях может быть от 1 до 10 нуклеоидов. При делении длинной митохондрии от нее отделяется участок, содержащий нуклеоид (сходство с бинарным делением бактерий). Количество ДНК в отдельных нуклеоидах митохондрий может колебаться в 10 раз в зависимости от типа клеток. При слиянии митохондрий может происходить обмен их внутренними компонентами.
рРНК и рибосомы митохондрий резко отличны от таковых в цитоплазме. Если в цитоплазме обнаруживаются 80s рибосомы, то рибосомы митохондрий растительных клеток принадлежат к 70s рибосомам (состоят из 30s и 50s субъединиц, содержат 16s и 23s РНК, характерные для прокариотических клеток), а в митохондриях клеток животных обнаружены более мелкие рибосомы (около 50s). В митоплазме на рибосомах идет синтез белков. Он прекращается, в отличие от синтеза на цитоплазматических рибосомах, при действии антибиотика хлорамфеникола, подавляющего синтез белка у бактерий.
На митохондриальном геноме синтезируются и транспортные РНК, всего синтезируется 22 тРНК. Триплетный код митохондриальной синтетической системы отличен от такового, используемого в гиалоплазме. Несмотря на наличие казалось бы всех компонентов, необходимых для синтеза белков, небольшие молекулы митохондриальной ДНК не могут кодировать все митохондриальные белки, только лишь их небольшую часть. Так ДНК размером 15 тыс.н.п. может кодировать белки с суммарным молекулярным весом около 6х105. В это же время суммарный молекулярный вес белков частицы полного дыхательного ансамбля митохондрии достигает величины около 2х106.


рис. Относительные размеры митохондрий у различных организмов.

Интересны наблюдения за судьбой митохондрий в дрожжевых клетках. В аэробных условиях дрожжевые клетки имеют типичные митохондрии с четко выраженными кристами. При переносе клеток в анаэробные условия (например, при их пересеве или при перемещении в атмосферу азота) типичные митохондрии в их цитоплазме не обнаруживаются, и вместо них видны мелкие мембранные пузырьки. Оказалось, что в анаэробных условиях дрожжевые клетки не содержат полную дыхательную цепь (отсутствуют цитохромы b и a). При аэрации культуры наблюдается быстрая индукция биосинтеза дыхательных ферментов, резкое повышение потребления кислорода, а в цитоплазме появляются нормальные митохондрии.
Расселение людей на Земле

Геном пластид

Подобно митохондриям, хлоропласты имеют собственную генетическую систему, обеспечивающую синтез ряда белков внутри самих пластид. В матриксе хлоропластов обнаруживаются ДНК, разные РНК и рибосомы. Оказалось, что ДНК хлоропластов резко отличается от ДНК ядра. Она представлена циклическими молекулами длиной до 40-60 мкм, имеющими молекулярный вес 0,8-1,3х108 дальтон. В одном хлоропласте может быть множество копий ДНК. Так, в индивидуальном хлоропласте кукурузы присутствует 20-40 копий молекул ДНК. Длительность цикла и скорость репликации ядерной и хлоропластной ДНК, как было показано на клетках зеленых водорослей, не совпадают. ДНК хлоропластов не состоит в комплексе с гистонами. Все эти характеристики ДНК хлоропластов лизки к характеристикам ДНК прокариотических клеток. Более того, сходство ДНК хлоропластов и бактерий подкрепляется еще и тем, что основные регуляторные последовательности транскрипции (промоторы, терминаторы) у них одинаковы. На ДНК хлоропластов синтезируются все виды РНК (информационная, трансферная, рибосомная). ДНК хлоропластов кодирует рРНК, входящую в состав рибосом этих пластид, которые относятся к прокариотическому 70S типу (содержат 16S и 23S рРНК). Рибосомы хлоропластов чувствительны к антибиотику хлорамфениколу, подавляющему синтез белка у прокариотических клеток.
рис.
Образование шпилек в ДНК некоторых хлоропластов.

Так же как в случае хлоропластов мы вновь сталкиваемся с
существованием особой системы синтеза белка, отличной от
таковой в клетке.

Эти открытия вновь пробудили интерес к теории симбиотического
происхождения хлоропластов. Идея о том, что хлоропласты
возникли за счет объединения клеток-гетеротрофов с прокариотическими
синезелеными водорослями, высказанная на рубеже XIX и XX
вв. (А.С. Фоминцин, К.С.Мережковский) вновь находит свое
подтверждение. В пользу этой теории говорит удивительное
сходство в строении хлоропластов и синезеленых водорослей,
сходство с основными их функциональными особенностями, и
в первую очередь со способностью к фотосинтетическим процессам.


рис. Состав генома пластид у арабидопсиса.

Известны многочисленные факты истинного эндосимбиоза синезеленых
водорослей с клетками низших растений и простейших, где
они функционируют и снабжают клетку-хозяина продуктами фотосинтеза.
Оказалось, что выделенные хлоропласты могут также отбираться
некоторыми клетками и использоваться ими как эндосимбионты.
У многих беспозвоночных (коловратки, моллюски), питающихся
высшими водорослями, которые они переваривают, интактные
хлоропласты оказываются внутри клеток пищеварительных желез.
Так, у некоторых растительноядных моллюсков в клетках найдены
интактные хлоропласты с функционирующими фотосинтетическими
системами, за активностью которых следили по включению С14О2.

Как оказалось, хлоропласты могут быть введены в цитоплазму
клеток культуры фибробластов мыши путем пиноцитоза. Однако
они не подвергались атаке гидролаз. Такие клетки, включившие
зеленые хлоропласты, могли делиться в течение пяти генераций,
а хлоропласты при этом оставались интактными и проводили
фотосинтетические реакции. Были предприняты попытки культивировать
хлоропласты в искусственных средах: хлоропласты могли фотосинтезировать,
в них шел синтез РНК, они оставались интактными 100 ч, у
них даже в течение 24 ч наблюдались деления. Но затем происходило
падение активности хлоропластов, и они погибали.

Эти наблюдения и целый ряд биохимических работ показали,
что те черты автономии, которыми обладают хлоропласты, еще
недостаточны для длительного поддержания их функций и тем
более для их воспроизведения.

В последнее время удалось полностью расшифровать всю последовательность
нуклеотидов в составе циклической молекулы ДНК хлоропластов
высших растений. Эта ДНК может кодировать до 120 генов,
среди них: гены 4 рибосомных РНК, 20 рибосомных белков хлоропластов,
гены некоторых субъединиц РНК-полимеразы хлоропластов, несколько
белков I и II фотосистем, 9 из 12 субъединиц АТФ-синтетазы,
части белков комплексов цепи переноса электронов, одной
из субъединиц рибулозодифосфат-карбоксилазы (ключевой фермент
связывания СО2), 30 молекул тРНК и еще 40 пока неизвестных
белков. Интересно, что сходный набор генов в ДНК хлоропластов
обнаружен у таких далеко отстоящих представителей высших
растений как табак и печеночный мох.

Основная же масса белков хлоропластов контролируется ядерным
геномом. Оказалось, что ряд важнейших белков, ферментов,
а соответственно и метаболические процессы хлоропластов
находятся под генетическим контролем ядра. Так, клеточное
ядро контролирует отдельные этапы синтеза хлорофилла, каротиноидов,
липидов, крахмала. Под ядерным контролем находятся многие
энзимы темновой стадии фотосинтеза и другие ферменты, в
том числе некоторые компоненты цепи транспорта электронов.
Ядерные гены кодируют ДНК-полимеразу и аминоацил-тРНК-синтетазу
хлоропластов. Под контролем ядерных генов находится большая
часть рибосомных белков. Все эти данные заставляют говорить
о хлоропластах, так же как и о митохондриях, как о структурах
с ограниченной автономией.

Транспорт белков из цитоплазмы в пластиды происходит в принципе
сходно с таковым у митохондрий. Здесь также в местах сближения
внешней и внутренней мембран хлоропласта располагаются каналообразующие
интегральные белки, которые узнают сигнальные последовательности
хлоропластных белков, синтезированных в цитоплазме, и транспортируют
их в матрикс-строму. Из стромы импортируемые белки согласно
дополнительным сигнальным последовательностям могут включаться
в мембраны пластиды (тилакоиды, ламеллы стромы, внешняя
и внутренняя мембраны) или локализоваться в строме, входя
в состав рибосом, ферментных комплексов цикла Кальвина и
др.

Удивительное сходство структуры и энергетических процессов
у бактерий и митохондрий, с одной стороны, и у синезеленых
водорослей и хлоропластов – с другой, служит веским аргументом
в пользу теории симбиотического происхождения этих органелл.
Согласно этой теории, возникновение эукариотической клетки
прошло через несколько этапов симбиоза с другими клетками.
На первой стадии клетки типа анаэробных гетеротрофных бактерий
включили в себя аэробные бактерии, превратившиеся в митохондрии.
Параллельно этому в клетке-хозяине прокариотический генофор
формируется в обособленное от цитоплазмы ядро. Так могли
возникнуть гетеротрофные эукариотические клетки. Повторные
эндосимбиотические взаимоотношения между первичными эукариотическими
клетками и синезелеными водорослями привели к появлению
в них структур типа хлоропластов, позволяющих клеткам осуществлять
автосинтетические процессы и не зависеть от наличия органических
субстратов (рис. 236). В процессе становления такой составной
живой системы часть генетической информации митохондрий
и пластид могла изменяться, перенестись в ядро. Так, например
две трети из 60 рибосомных белков хлоропластов кодируется
в ядре и синтезируются в цитоплазме, а потом встраивается
в рибосомы хлоропластов, имеющие все свойства прокариотических
рибосом. Такое перемещение большой части прокариотических
генов в ядро привело к тому, что эти клеточные органеллы,
сохранив часть былой автономии, попали под контроль клеточного
ядра, определяющего в большей степени все главные клеточные
функции.

Транскрипция

Транскрипция

Общие сведения

Транскрипция — процесс синтеза РНК с использованием ДНК в качестве матрицы, происходящий во всех живых клетках. Другими словами, это перенос генетической информации с ДНК на РНК.
В процессе транскрипции генов происходит биосинтез молекул РНК, комплементарных одной из цепей матричной ДНК, сопровождаемый полимеризацией четырех рибонуклеозидтрифосфатов (ATP, GTP, CTP и UTP) с образованием 3'–5'-фосфодиэфирных связей и освобождением неорганического пирофосфата.
Транскрипция катализируется ферментом ДНК-зависимой РНК-полимеразой. Процесс синтеза РНК протекает в направлении от 5'- к 3'- концу, то есть по матричной цепи ДНК РНК-полимераза движется в направлении 3'->5'
РНК-полимеразы могут состоять из одной или нескальких субъединиц. У митохондрий и некоторых бактериофагов, например SP6, T7 с небольшим числом генов простых геномов, где отсутствует сложная регуляция РНК-полимераза состоит из одной субъединицы. Для бактерий и эукариот, с большим числом генов и сложными системами регуляции РНК-полимеразы состоят из нескольких субъединиц. Показано, что фаговые РНК-полимеразы состоящие из одной субъединицы могут взаиодействовать с белками бактерий, которые меняют их свойства [Патрушев, 2000].
У прокариот синтез всех видов РНК осуществляется одним и тем же ферментом.
У эукариот - 3 ядерные РНК-полимеразы, митохондриальные РНК-полимеразы, хлоропластные РНК-полимеразы.
Субстратами для РНК-полимераз служат рибонуклеозид-трифосфаты (активированные нуклеотиды). Весь процесс транскрипции осуществляется за счет энергии макроэргических связей актвированных нуклеотидов.

Первый нуклеотид в РНК всегда пурин в форме трифосфата.
Факторы транскрипции - белки взаимодействующие с друг другом, регуляторными участками ДНК и РНК-полимеразой с образованием транскрипционного комплекса и регулирующие транскрипцию. Благодаря факторам транскрипции и регуляторным последовательностям генов становится возможным специфический синтез РНК.
Принципы транскрипции
комплиментарность - mRNA комплиментарна матричной цепи ДНК и аналогична кодирующей цепи ДНК
антипараллельность
униполярность
беззатравочность - РНК-полимераза не требует праймера
асимметричность
Стадии транскрипции
  1. распознавание промотора и связывание - РНК-полимераза связывается с ТАТА-боксом 3’-промотора при помощи основных факторов транскрипции, дополнительные факторы ингибируют или стимулируют присоединение
  2. инициация - образование первой фосфодиэфирной связи между Pu и первым нуклеотидом. К пуринтрифосфату присоед нуклеотид комплиментарный второму нуклеотиду ДНК с отщеплением пирофосфата от нуклеозидтрифосфата с образ диэфирной связи
  3. элонгация ( 3’→5’)- мРНК гомологичная нематричной (кодирующей, смысловой) ДНК, синтезируется на матричной ДНК; какая из двух цепей ДНК будет матрицей, определяется направлением промотора
  4. терминация

Транскрипционные фабрики

Существует ряд экспериментальных данных, свидетельствующих о том, что транскрипция осуществляется в так называемых транскрипционных фабриках: огромных, по некоторым оценкам, до 10 МДа комплексах, которые содержат около 8 РНК-полимераз II и компоненты последующего процессинга и сплайсинга, а также пруф-ридинга новосинтезированного транскрипта. В ядре клетки происходит постоянный обмен между пулами растворимой и задействованной РНК-полимеразы. Активная РНК-полимераза задействована в таком комплексе, который в свою очередь является структурной организовывающей компактизацию хроматина единицей. Последние данные. свидетельствуют о том, что транскрипционные фабрики существуют и в отсутствие транскрипции, они фиксированы в клетке (пока не ясно, взаимодействуют ли они с матриксом клетки или нет) и представляют собой независимый ядерный субкомпартмент. Попытки выделить белковый функциональный комплекс транскрипционной фабрики пока не привели к успеху ввиду его огромных размеров и низкой растворимости.

Транскрипция у эукариот

РНК-полимеразы эукариот

У эукариот имеется 3 типа РНК-полимераз (не считая митохондриальной и хлоропластной):
РНК полимеразаI - синтезирует в ядрышках рибосомные RNA (18S и 28S рРНК, кроме 5S);
РНК-полимеразаII - синтезирует mRNA и некоторых sRNA;
РНК-полимеразаIII - синтезирует tRNA, sRNA, 5S rRNA.
RNA-полимеразы эукариот отличаются: количеством субъединиц – 2 большие (120-220кДа) и до 8 малых (10-100кДа), потребностью в ионах Mg и Mn, чувствительностью к – амонитину - токсину бледной поганки - пептиду включающему D-аминокислоты: polI - устойчива, polII - ингибируется при концентрации 10-8М, polIII - при 10-6М амонитина. РНК-полимеразы I,II,III кодируются в ядре. Большие субъединицы гомологичны β и β`-субъединицам эубактерий.

РНК-полимераза I

РНК-полимераза II

PolII Человека содержит более 10 субъединиц, слабо ассоциирующих друг с другом. Некоторые из них принадлежат к основным факторам транскрипции (GTF).
Белки holo-фермента PolII дрожжей [Патрушев, 2000].
Pol II - РНК-Полимеразная активность, взаимодействует с множеством общих и тканеспецифических факторов транскрипции, участвует в выборе точки инициации транскрипции.
TFIIB - Связывает Pol II и TBP на промоторе, участвует в выборе точки инициации транскрипции
TFIIF - Взаимодействует с Pol II, стимулирует элонгацию транскрипции Pol II, компонент субкомплекса SRB/медиатор
TFIIH - Активность ДНК-зависимой ATPазы, ДНК-геликазная активность, обладает активностью CTD-киназы
SRB2, SRB5 - Участвуют в образовании инициационного комплекса, стимулируют базальный и индуцированный синтез РНК,
взаимодействуют с TBP, компоненты субкомплекса SRB/медиатор
GAL11/SPT13 - Участвуют в образовании инициационного комплекса, стимулируют базальный и индуцированный синтез РНК,
компоненты субкомплекса SRB/медиатор, предположительно взаимодействуют с активаторами транскрипции
SUG1 - Компонент субкомплекса SRB/медиатор, предположительно взаимодействует с активаторами транскрипции
SRB4, SRB6, SRB7, SRB8, SRB9, SRB10, SRB11 - Компоненты субкомплекса SRB/медиатор, предположительно
взаимодействуют с CTD-доменом Pol II

РНК-полимераза III

Факторы транскрипции

Инициация

Инициация транскрипции происходит на кэп-сайте кодирующем первый нуклеодид первого экзона мРНК.
ТАТА-бокс локализуется в 25-30 пн выше кэп-сайта связывая РНК-полимеразу перед кэп-сайтом. Промотор - примерно 200 пн выше кэп-сайта. Энхансеры обычно имеют длину 100-200 пн.

Элонгация

Терминация

Терминация на сайте полиаденилирования.

Вновь синтезированная РНК генов связывается с ядерными белками - информомерами, подвергается различным посттранскрипционным модификациям и транспортируется из ядра (см. обзор Процессинг) для последующей трансляции (см. обзор Трансляция).

Транскрипция у прокариот

РНК-полимераза E.coli

РНК-полимераза E.coli осуществляет транскрипцию всех бактериальных генов и состоит из нескольких субъединиц: α-35кДа, β‘-165кДа, β-155кДа, σ-чаще 70кДа (σ70). РНК-полимераза состава ααββ’σ70 называется holo-фермент (Еσ70), состава ααββ’- core-фермент (E).
σ - сменный фактор специфичности, который диссоциирует после инициации транскрипции. Элонгация и терминация осуществляется core-ферментом. У Е.coli ~10 видов σ-субъединиц. Транскрипция генов теплового шока, оперонов gln или nif осуществляется σ54 в составе holo-фермента Eσ54 (54 кДа).
Все субъединицы заряжены отрицательно: σ>α>β>β’ – расположены по убыванию заряда. В каждой субъединице имеется кластер (+)-заряженных участков, которыми они связываются с ДНК. Наибольшее число кластеров у – β’, который участвует в связывании фермента с ДНК, β-субъединица содержит активные центры - инициации и элонгации, α-субъединицы обеспечивают правильное взаимодействие фермента с промоторами. Рифампицин – блокирует инициацию, стрептолидигин – блокирует элонгацию, что говорит о разнесении активных центров в РНК-полимеразе.
Узнавание и связывание RNA-pol с промотором осуществляется holo-ферментом
Одновременно в клетке присутствует около 7000 молекул РНК-полимеразы. Только holo-фермент обладает высоким сродством к специфической последовательности нуклеотидов - промотору, сродство к остальным случайным последовательностям ДНК у него снижено в 10000 раз. У core-фермента одинаковое сродство к любой последовательности нуклеотидов.
Сам по себе сигма - фактор обладает наименьшим сродством к ДНК по сравнению с другими субьединицами РНК-полимеразы, однако он придает holo-ферменту такую конформацию, которая обладает повышенным сродством к промотору.
Стадии узнавания и связывания, а также инициации осуществляются holo-ферментом. Элонгация и терминация осуществляются core-ферментом.
Две α субъединицы - каркас РНК-полимеразы. К ним крепятся остальные субъединицы.
β' - субъединица отвечает за прочное связывание с ДНК за счет кластера положительно заряженных аминокислот.
В β - субъединице находятся два каталитических центра. Один отвечает за инициацию, а другой - за элонгацию. Один центр работает в holo-, а другой - в core- ферменте.

Инициация транскрипции

РНК-полимераза Ecoli узнает два 6н разделенных 25н

Элонгация транскрипции

Терминация транскрипции

Регуляция транскрипции

Схема негативной индукции Жакоба и Моно

негативная регуляция транскрипции Lac-оперона

Lac-оперон E. coli содержит 3 гена, отвечающие за образование белков, участвующих в переносе в клетку дисахарида лактозы и в ее расщеплении.
Z-β - галактозидаза (расщепляет лактозу на глюкозу и галактозу).
Y-β- галактозидпермеаза (переносит лактозу через мембрану клетки).
А - тиогалактозидтрансацетилаза (ацетилирует галактозу).
В отсутствие в клетке лактозы lac-оперон выключен. Активный белок - репрессор, кодируемый в моноцистронном опероне (LacI) , не имеющем оператора, связан с оператором lac-оперона. Поскольку оператор перекрывается с промотором, даже посадка РНК-полимеразы на промотор невозможна.
Как только некоторое количество лактозы попадает в клетку, две молекулы субстрата (лактозы) взаимодействуют с белком - репрессором, изменяют его конформацию - и он теряеет сродство к оператору.
Тут же начинается транскрипция lac-оперона и трансляция образующейся mРНК; три синтезируемых белка участвуют в утилизации лактозы.
Когда вся лактоза переработана, очередная порция репрессора, свободного от лактозы, выключает lac-оперон.

Схема позитивной индукции


В Аra-опероне E. сoli 3 цистрона, которые кодируют ферменты, расщепляющие сахар арабинозу. В норме оперон закрыт. Белок - репрессор связан с оператором.

Когда в клетку попадает арабиноза, она взаимодействует с белком - репрессором. Белок - репрессор меняет конформацию и превращается из репрессора в активатор, взаимодейсивующий с промотором и облегчающий посадку РНК-полимеразы на промотор.
Эта схема регуляции называется позитивной индукцией, поскольку контролирующий элемент - белок - активатор "включает" работу оперона.

Схема позитивной репрессии

В опероне синтеза рибофлавина у Вacilus subtilis располагаются цистроны ферментов синтеза рибофлавина. Есть белок-активатор, обеспечивающий посадку РНК-полимеразы на промотор. В норме оперон открыт. Образуется N молекул рибофлавина.

N+1-ая молекула (лишняя) взаимодействует с активатором и он теряет способность активировать посадку РНК-полимеразы на промотор.

Позитивная репрессия, поскольку в регуляции участвует белок - активатор, а сама регуляция заключается в выключении транскрипции.

Схема негативной репрессии

В опероне синтеза триптофана у E. сoli имеется 5 цистронов, которые кодируют ферменты последовательной цепи реакций синтеза триптофана. В норме оперон включен. Белок - репрессор неактивен (в форме апо-репрессора), он не способен садиться на оператор.

Клетке нужно N молекул триптофана. N+1-ая молекула взаимодействует с апо-репрессором. Он меняет конформацию, садится на оператор и синтез РНК прекращается.

Схема регуляции - негативная репрессия, потому что белок репрессор "выключает" оперон.

Позитивный контроль работы lac-оперона

Lac-оперон, подчиняющийся схеме негативной индукции, имеет и позитивный контроль. цАМФ образуется из АТФ ферментом аденилатциклазой. Фосфодиэстераза превращает цАМФ в АМФ. Глюкоза активирует второй и инактивирует первый фермент. Чем больше в клетке глюкозы, тем меньше цАМФ.

Если нет глюкозы, то цАМФ соединяется с белком катаболической репрессии (САР) и образуется комплекс САР•цАМФ, активирующий посадку РНК-полимеразы на промотор. В присутствии лактозы lac-оперон включается и работает. Если же в клетке есть еще и глюкоза (более экономичный источнок энергии), то нет цАМФ - и активатор не образуется, lac-оперон работает слабо, без дополнительной индукции.

Процессинг РНК

Изучения SSR полиморфизма

Кепирование

Кэпирование 5’-конца транскрипта 7’-метил ГТФ, защищает от 5’-экзонуклеазы
кепирование ГТФ + гуанинтрансфераза (Е)→ Е~фГ + ф-ф
5'ф-ф-ф-Пур-ф-Х-ф-Y-ф-Z-...+E~фГ? Г5'-ф-ф-ф-5'-Пур-ф-Х-ф-Y-ф-Z...?
(метилирование) Гm-ф-ф-ф-Пурm-ф-Хm-ф-Y-ф-Z-... | защита 5’мРНК от экзонуклеаз, правильная установка РНК на рибосоме при взаимод. белков с кэпом
cap

Полиаденилирование

мРНК гистоновых генов и ряда других не полиаденилируется. Полиаденилированные про-mРНК подвергаются сплайсингу. После синтеза про-mРНК на расстоянии примерно 20 н в направлении 3'-конца от последовательности 5'-AAУAA-3' происходит разрезание эндонуклеазой и к новому 3'-концу присоединяется от 30 до 300 остатков АМФ (безматричный синтез). ПолиА хвост защищает 3'-конец от гидролиза, т.к. покрыт полиА-связывающими белками. Время жизни mРНК зависит от длинны полиА-хвоста.

Polyadenylation is the covalent linkage of a polyadenylyl moiety to a messenger RNA (mRNA) molecule. It is part of the route to producing mature messenger RNA for translation, in the larger process of protein synthesis to produce proteins. In eukaryotic organisms, polyadenylation is the mechanism by which most messenger RNA molecules are terminated at their 3' ends. The polyadenosine (poly-A) tail protects the mRNA molecule from exonucleases and is important for transcription termination, for export of the mRNA from the nucleus, and for translation. Some prokaryotic mRNAs also are polyadenylated, although the polyadenosine tail's function is different from that in eukaryotes.

Polyadenylation occurs during and immediately after transcription of DNA into RNA in the nucleus. After transcription has been terminated, the mRNA chain is cleaved through the action of an endonuclease complex associated with RNA polymerase. The cleavage site is characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA has been cleaved, 50 to 250 adenosine residues are added to the free 3' end at the cleavage site. This reaction is catalyzed by polyadenylate polymerase.

Polyadenylation Process

The Process of PolyadenylationCleavage and Polyadenylation Specificity Factor (CPSF) and Cleavage Stimulation Factor (CstF), both of which are multi-protein complexes, start bound to the rear of the advancing RNA polymerase II.
As the RNA polymerase II advances over the adenylation signal sequences CPSF and CstF transfer to the new pre-mRNA, CPSF binding to the AAUAAA sequence, and CstF to the GU or U rich sequence following it.
CPSF and CstF promote cleavage approximately 35 nucleotides after the end of the AAUAAA sequence. Immediately Polyadenylate Polymerase (PAP) starts writing the polyadenosine tail. Polyadenosine Binding (PAB) protein immediately binds to the new polyadenosine sequence.
CPSF dissociates, and polyadenylation by PAP continues to write an adenosine tail of approximately 50 to 250 nucleotides, depending on the organism. PAB acts as some kind of molecular ruler, specifying when polyadenylation should stop.
PAP dissociates, and PAB remains bound. Along whith the 5' cap it is thought this helps target the mRNA for nuclear export.
Polyadenylation is initially dependent on CPSF and the AAUAAA sequence (for the first 10 As or so), after which polyadenylation is simply dependent on the existing poly A tail.

Редактирование

цитохромоксидаза в митохондниях трипаносомы-четвертичную
стр-ра, из 3-х разных субъединиц. Человек (постоянный хозяин
трипаносомы) теплокровен, поэтому трипаносоме не нужна энергия
собственных митохондрий. Синтезируются только две субъединицы
цитохромоксидазы. Муха цеце (промежуточный хозяин трипаносомы)
- холоднокровна. Трипаносоме нужен работающий фермент. Все
три субъединицы синтезируются. В геноме трипаносомы только
два гена для двух субъединиц. В mРНК одного из них происходит
разрезание и встраивание 4-х урацилов (на небольшом расстоянии
др от др, но не подряд). Происходит сдвиг рамки считывания
и отредактированная mРНК кодирует новый полипептид - третью
субъединицу цитохромоксидазы.

RNA: AUAUCAAGUUUAGGUAUAAAAGUAGAUUGUAUACCUGGUAGGUGUAAU

белок coxII: ISSLGIKVENLVGVM |

белок coxIII: ISSLGIKVDCIPGRCN

Сплайсинг

Схема сплайсинга

Многие гены состоят из экзонов - кодирующие участки и интронов – некодирующие участки. При транскрипции с гена считывается РНК несущая как экзоны, так и интроны. В процессе сплайсинга интроны вырезаются, а экзоны сшиваясь образуют зрелую РНК.
Характеристика экзонов и интронов некоторых генов.

продукт гена организм длина экзонов, пн
интроны
число общая длина, пн
аденозиндезаминаза человек 1500 11 30000
аполипротеин B человек 14000 28 29000
β-глобин мышь 432 2 762
цитохром b митохондрии дрожжей 2200 6 5100
дигидрофолатредуктаза мышь 568 5 31500
эритропоэтин человек 582 4 1562
фактор V[1] человек 9000 25 177000
фиброин шелка шелкопряд 18000 1 970
гипоксантин-фосфорибозилтрансфераза мышь 1307 8 32000
α-интерферон человек 600 0 0

Сплайсосомы

У эукариот в большинстве кодирующих белки РНК интроны вырезаются в сплайсосомах - комплексах, состоящих из пяти малых ядерных нуклеопротеинов (snRNP, или SNURPs - снурпс). Интроны содержат последовательности, необходимые для вырезания - 3'-сайт (акцепторный), 5'-сайт (донорный) и бранч-сайт (см. рис.2). РНК в snRNA взаимодействует с этими сайтами, способствуя вырезанию интронов.




рис.2 Консервативные последовательности в экзонах и интронах необходимые для сплайсинга.

Обнаружено два типа сплайсосом - большие и малые, состоящие из разных snRNP.

Большие сплайсосомы состоят из U1, U2, U4, U5 и U6 snRNP; транскрипция U1-U5 РНК осуществляется РНК-полимеразой II, а U6 - РНК полимеразой III. Вырезают интроны имеющие GU на 5'-сайте и AG на 3'-сайте. U1 связываются с 5'-сайтом, U2 связываются с бранч-сайтом и U6. U4 ингибирует U6, инактивируя сплайсосому. U5 связывает U1 и U2 при образовании 'лассо'. При активации U6, U1 перемещается и связывает U2. U2-U6 формируют активный католитический комплекс (см. рис.3).




рис.3 Сплайсосома и взаимодействие ее компонентов с экзонами и интронами РНК.

Малые сплайсосомы. Сплайсируют РНК, содержащие AU 3'- и AC 5'-концы интронов. Cостоят из U11, U12, U4atac, U6atac и U5 - одинакового для больших и малых сплайсосом.




рис.4 Механизм удаления интронов.

Малые РНК. sРНК 103-105 копий на клетку, обогащены урацилом U1, U2... 100-300н, кодируются в ядре, но работают как в ядре (small nuclear - SN), так и в цитоплазме (small cytoplasmic - SC)

SNURPS - РНП (рибонуклеопротеидные комплексы) в ядре. snРНК входят в состав РНП, участвующих в полиаденилированиии и сплайсинге | SCURPS - РНП в цитоплазме, входят в состав информосом | U4 в комплексах, участвующих в полиаденилировании (при красной волчанке (аутоимунном заболевании) вырабатываются антитела к белкам комплекса с U4 нет полиаденилирования и сплайсинга) | Гистоновая mРНК не полиаденилируется т.к sРНКU7, комплементарная 3'-концу гистоновой mРНК, защищает ее от полиаденилирования.

Сплайсинг может иметь позитивную и негативную регуляцию. При позитивной регуляции из первичного транскрипта вырезается интрон при действии белка активатора. При негативной первичный транскрипт не подвергается сплайсингу при действии
белка репрессора.


Транс-сплайсинг

Транс-сплайсинг - форма
сплайсинга, при которой соединяются РНК разных транскриптов.


Альтернативный сплайсинг

mРНК кальцитонинового гена у млекопитающих (крыса)

Во всех клетках есть кальцитониновый ген, но в клетках щитовидной железы он экспрессируется в виде гормона кальцитонина, а в клетках гипофиза - нейропептида CGRP (пептида, имеющего отношение к гену кальцитонина). Ген один, а белки получаются разные в результате сплайсинга mРНК и процессинга полипептидов. В клетках других тканей этот ген не экспрессируется.

Сплайсинг осуществляется белковыми комплексами – сплайсосомами-ферменты, вырезающие и сшивающие участки про-mРНК, белки, придающие про-mРНК нужную конформацию, sPНК. Сплайсосома связана с ферментами полиаденилирования.


рис. Схема образования различных мРНК из
одного тропомиозинового гена в различных клетках.


Автосплайсинг

Автосплайсинг - вид сплайсинга, когда интроны кодируют рибозимы - РНК с каталитической активностью, выполняющие роль сплайсосомы. Имеются три группы интронов кодирующих рибозимы Group I, II и III. Group II и III выполняют роль сплайсосомы без привлечения
других белков.

Автосплайсинг открыт Томасом Чеком (США) в 1982 году. Он работал с инфузорией

Tetrаchymenа thermophyla
. У этой инфузории образуется 35S про-rРНК длиной 6400 нуклеотидов. Без участия дополнительных соединений белковой природы из этой про-rРНК вырезается внутренний участок длиной в 414 нуклеотида. Два экзона сшиваются с образованием 26S rРНК. Единственное требование - определенная концентрация ионов магния. Про-rРНК имеет третичную структуру и обладает каталитичекой активностью. Впервые было показано, что каталитической активностью
обладают не только белки.

Small nuclear RNAs (snRNAs), ranging in size from about 80 to 350 nucleotides, are ubiquitous components of eukaryotic cells. The U (uridine-rich) family of snRNAs are thought to be important for RNA splicing and have been highly conserved in evolution. They are associated with specific polypeptides, forming small nuclear ribonucleoprotein complexes (snRNPs). These are often targets of the autoimmune disorder systemic lupus erythematosus. The polypeptide associated with U1 snRNA appears to be unique (Wooley et al., 1983). Multigene families for human U1, U2, U3, U4 and U6 snRNAs have been demonstrated. Transcription of U1-U5 RNAs is accomplished by RNA polymerase II, whereas U6 snRNA is thought to be transcribed by RNA polymerase III. Kunkel and Pederson (1988) studied the upstream regulatory elements for the human U6 RNA gene and found a marked similarity to the proximal control elements of U1 and U2 snRNA genes, despite the transcription by different polymerases. Most of the human genes complementary to these snRNAs are pseudogenes, which are dispersed in the genome. Although most of the U1 genes are on chromosome 1, they probably are separated by intergenic spacer regions larger than 15 kb, because none of the recombinant phages isolated to date contains more than one U1 gene. By way of contrast, U2 snRNA genes are organized as a nearly perfect tandem array of 10 to 20 copies per haploid genome (Van Arsdell and Weiner, 1984). Bostock et al. (1984) concluded that the genes for human U1 snRNA are clustered on the short arm of chromosome 1. By somatic cell hybrid studies, Naylor et al. (1984) found that RNU1 segregated with PEPC (170000) and AK2 (103020), chromosome 1 markers. By in situ hybridization, they showed that most of the grains were concentrated in band 1p36.3. By in situ hybridization, Lindgren et al. (1985) found that the U1 snRNA pseudogenes (called class I) are coded in a cluster in 1q12-q22, separate from the true genes (in about 30 copies) in 1p36. Bernstein et al. (1985) presented evidence in support of the idea that the true U1 genes were derived by gene amplification and transposition from a more ancient family of U1 genes (represented now by class I U1 pseudogenes). The clustering of both U1 true genes and pseudogenes and the conservation of at least 44 kb of DNA flanking the U1 coding region in a large fraction of the 30 true U1 genes
are explained by gene amplification.

Pseudogenes for U1 snRNA outnumber the true genes by 15- to 30-fold. Some of the pseudogenes have no flanking homology to the true genes, but others, the class I pseudogenes, share several kilobases of flanking homology. Lindgren et al. (1985) noted that the site of the U1 pseudogenes corresponds to a site of chromosomal modification by adenovirus-12. They postulated that class I U2 pseudogenes may be affected by the virus because they retain flanking regulatory sequences.

Трансляция

Трансляция

Общие сведения

Трансляция - это процесс, в результате которого рибосомы считывают генетическую информацию матричных РНК и создают белковый продукт в соответствии с этой информацией.
Специфические молекулы транспортрых РНК (тРНК) служат посредниками между кодом мРНК и конечной белковой последовательностью. В их состав входит последовательность, узнающая код мРНК и соответствующая этому коду аминокислота.
События трансляции разделяют на последующие события: инициацию, элонгацию и терминацию. На стадии инициации рибосома связывает мРНК и первая аминокислота присоединяется к рибосоме. Во время элонгации происходит рост полипептидной цепи. На стадии терминации рибосома отделяется от мРНК и процес трансляции заканчивается. У прокариот и эукариот процессы трансляции схожи, но имеются и существенные различия.
Трансляция происходит в цитоплазме, где находятся рибосомы. В зависимости от дальнейшего преднозначения синтезируемых белков, они могут образовываться либо в цитозоле, либо на поверхности шероховатого эндоплазматического ретикулума.
Схема типичной мРНК эукариот
Полипептидные цепи синтезируются однонаправленно: с амино-конца к карбокси-концу.
Схема направлений синтеза белка при трансляции
При инициации первая и вторая молекулы аминоацил-тРНК спариваются с первыми двумя кодонами мРНК. Далее трансляция продолжается в направлении 5'–>3' кодон за кодоном до тех пор, пока не достигнет стоп-сигнала, расположенного сразу же за кодоном, детерминирующим С-концевую аминокислоту.

Литература: 

К сожалению, список литературы отсутствует.

Генетический код

Литература: 

К сожалению, список литературы отсутствует.

Трансляция у эукариот

Вместо комплементарного РНК-РНК узнавания, в которое вовлечена прединициирующая последовательность Шайна-Дальгарно прокариотических мРНК, эукариотические мРНК узнаются эукариотическими рибосомами по кэпированному 5'-концу с обязательным участием белка, например, eIF-4F инициаторного фактора ( Rhoads, 1988 ). Предполагается, что этот белок участвует в расплавлении вторичных структур 5'- областей мРНК, облегчая их связывание с малыми субчастицами рибосом. В отличие от прокариот, эукариотическая мРНК образует комплексы с белками ( мРНП , или мессенджер-рибонуклеопротеиды, или информосомы ), что обусловливает ее метаболическую стабильность. Вследствие этого у эукариот отсутствует постоянная интенсивная деградация и интенсивный ресинтез мРНК, которые, как правило, моноцистронны и имеют специфически модифицированный (кэпированный) 5'-конец. Все это обусловливает целый ряд особенностей инициации трансляции и ее регуляции у эукариотических организмов. Естественно, что метаболическая стабильность эукариотической мРНК делает регуляцию на уровне трансляции особенно важной в общей картине регуляции биосинтеза белка ( Спирин, 1986 ).

Литература: 

К сожалению, список литературы отсутствует.

Трансляция у прокариот

бактерия E.coli - трансляция этой бактерии наиболее изучена Трансляция бактерии E.coli наиболее изучена

Синтез белка происходит на рибонуклеопротеиновом комплексе - рибосоме, в процессе трансляции mRNA. Рибосома состоит из большой и малой субъединиц, которые соединены в области инициации трансляции (translation initiation region -TIR) mRNA во время стадии инициации трансляции. Во время элонгации рибосома скользит вдоль mRNA и синтезирует полипептидную цепь. Элонгация продолжается до тех пор, пока рибосома не достигает стоп-кодона на mRNA - терминация трансляции. После терминации рибосома отделяется от синтезированного полипептида и способна снова повторить цикл трансляции mRNA.
Каждая стадия трансляции имеет свои регуляторные факторы, но у эукариот этих факторов гораздо больше, чем у прокариот.
Инициация

Инициация

Последовательность сборки инициаторного комплекса трансляции у бактерийПоследовательность инициации трансляции у бактерии. 30S и 50S рибосомные субъединицы показаны светлым и темным серым цветом. [Laursen, et al. 2005]

Рибосомы прокариот инициируют трансляцию на мРНК уже во время транскрипции. Время необходимое для посадки рибосом порядка секунд, хотя это зависит от каждой мРНК. Рибосомы транслируют мРНК со скоростью приблизительно 12 аминокислот в секунду.
В инициации трансляции участвуют: рибосома, аминоацилированная и формилированная тРНК (fMet-tRNAfMet), мРНК и три белковых инициирующих фактора IF1, IF2 и IF3.
Бактериальная 70S рибосома состоит из большой 50S и малой 30S субъединицы. Имеется три tRNA связывающих сайта аминоацил - aminoacyl (A), пептидил - peptidyl (P), и сайт выхода - exit (E). Присоединение фактора IF3 к 30S рибосомной субъединице обеспечивает распад рибосомы на субъединицы. Фактор инициации IF1 связывается с A-сайтом 30S рибосомной субъединицы и служит инициатором присоединения tRNA к рибосомному P-сайту блокируя A-сайт. IF1 стимулирует активность IF3 и также распад рибосомных субъединиц.
После распада субъединиц, IF2, mRNA и fMet-tRNAfMet соединяются с 30S рибосомной субъединицей. Последовательность Шайно-Дальгарно (Shine-Dalgamo -SD) mRNA взаимодействует с anti-SD последовательностью 16S rRNA и инициирующий кодон присоединяется в Р-сайте рибосомы. Инициирующие факторы, особенно IF3, способствуют этому присоединению.
Инициаторная tRNA устанавливается в P-сайте 30S рибосомной субъединицы в три шага не зависимо от кодона, зависимо от кодона и fMet-tRNAfMet присоединение.
Все три шага обеспечиваются фактором IF2, который взаимодействует с fMet-tRNAfMet на рибосоме. IF3 стабилизирует присоединение fMet-tRNAfMet к рибосомному P-сайту и стабилизирует кодон-антикодон взаимодействие.

30S преинициаторный комплекс состояций из 30S рибосомной субъединицы, трех инициаторных факторов, mRNA в стартовой позиции, где fMet-tRNAfMet связана кодон независимо. Такой относительно нестабильный комплекс подвергается конформационному изменению, что обеспечивает кодон-антикодон взаимодействие и формирует более стабильный 30S инициаторный комплекс. Инициаторные факторы IF1 и IF3 отсоединяются, тогда как IF2 фактор стимулирует взаимодействие с 50S рибосомной субъединицей. После сборки рибосомы IF2 покидает комплекс. Во время этого процесса GTP связанный с IF2 гидролизуется до GDP и Pi. Вновь образованный 70S инициаторный комплекс, содержащий fMet-tRNAfMet как субстрат для пептидилтрансферазного центра 50S рибосомной субъединицы готов к вступлению в фазу элонгации трансляции.

Факторы инициации: IF-1, IF-2, IF-3 - белки временно связывающиеся с рибосомой, необходимые для инициации.

Этапы инициации трансляции

:

1. Факторы инициации IF-1 и IF-3 связываются с 30S-субчастицей, что обеспечивает ее взаимодействие с IF-2, инициаторной формилметиониновой-тРНК (Fmet-тРНКFMet) и GTP.

2. При связывании инициаторных белков IF-1 и IF-2 с 30S-субчастицей происходит диссоциация 70S-рибосомы на две субъединицы.

3. Комплекс 30S-субъединицы со всеми факторами инициации и Fmet-тРНКFMet связывается с 5'-концом мРНК вблизи кодона AUG и узнает. AUG-кодон мРНК.

Связывание 30S-субчастицы с мРНК находится под строгим контролем нуклеотидной последовательности, расположенной примерно
за 10 нуклеотидов до 5'-конца инициаторного кодона. Взаимодействию способствует комплементарное спаривание этой богатой пуринами по следовательности из 5-8н, называемой последовательностью Шайна-Дальгарно, с полипиримидиновым участком, находящимся вблизи 3'-конца 16S-pPHK.

4. Формирование полноценного функционального комплекса инициации завершается ассоциацией 50S-субчастицы с преинициаторным комплексом. При ассоциации 70S-рибосомы образуются два активных центра: Р- и А-участки. Fmet-TPHKFMet занимает Р-участок.

5. С образованием функциональной 70S-субчастицы отделяются все три белка инициации.

Элонгация

Факторы элонгации: EF-Tu и EF-Ts - белки связывающиеся с рибосомой, необходимые для элонгации трансляции.
В процессе инициации образуется 70S-рибосома связанная с мРНК, в Р-центре которой находится Fmet-тPHKFMet
Для образования первой пептидной связи необходимо, чтобы
аминоацил-тРНК, соответствующая следующему кодону, заняла А-центр.
Этапы элонгации трансляции:
1. EF-Tu-GTP связывает все аминоацил-тРНК, кроме Fmet-тPHKFMet, и доставляет их к А-центру комплекса 70S-рибосома-мРНКАминоацил-тРНК связывает EF-Tu и GTP. Образовавшийся комплекс (аминоацил-тРНК-[ЕF-Тu-GТР]) доставляет аминоацил-тРНК к А-участку. GTP гидролизуется, и комплекс (EF-Tu-GDP) отделяется от рибосомы. EF-Ts восстанавливает EF-Tu-GDP.

2. Когда оба участка, А и Р, заняты, пептидилтрансферазная активность 50S-субчастицы катализирует перенос группы Fmet с ее тРНК на аминогруппу аминоацил-тРНК, находящейся в А-участке. В результате в А-участке оказывается дипептидил-тРНК, а в Р – свободная тРНК.

3. тРНК освобождает Р-участок, образовавшаяся дипептидил-тРНК переместиться на него, а новый кодон должен быть готов к тому, чтобы занять освободившийся А-участок. Все эти процессы
осуществляются с помощью EF-G при GTP-зависимой транслокации рибосомы.

4. Теперь новый кодон, занявший А-сайт, готов к спариванию с родственной аминоацил-тРНК. Сразу после связывания аминоацил-тРНК с А-
участком высвобождается комплекс EF-Tu-GDP и происходит регенерация функционально активного EF-Tu-GTP. При этом EF-Tu-GDP взаи- модействует с белком EF-Ts, что приводит к отделению GDP и образованию комплекса EF-Tu•EF-Ts. Далее EF-Tu•EF-Ts взаимодействует с GTP, происходит регенерация EF-Tu-GTP и отделение EF-Ts, и оба соединения оказываются готовыми к следую- щему циклу.

Для прочтения следующего кодона и удлинения полипептидной цепи еще на одну аминокислоту вся серия реакций должна повториться.

При образовании каждой пептидной связи расходуется энергия, равная четырем энергетическим эквивалентам (если за один эквивалент принять энергию образования фосфатной связи): два эквивалента АТР потребляются при аминоацилировании тРНК и два эквивалента GTP-

в каждом цикле элонгации.

2. При инициации трансляции IF-2 узнает Fmet-тРНКFMet среди всех других аминоацил-тРНК, a EF-Tu отличает met-тРНКF Met от
Fmet-тРНКM Met при внедрении в А-участок.

3. Факторы элонгации EF-Tu и EF-G то присоединяются, то отделяются от рибосомы в зависимости от того, связаны ли они с GTP или с GDP соответственно.

4. Растущая полипептидная цепь всегда соединена своим карбоксильным концом с тРНК, которая соответствует С-концевой аминокислоте в растущей полипептидной цепи.

5. Пептидилтрансфераза катализирует формирование пептидных связей между карбоксильным концом растущей цепи и аминогруппой аминоацил-тРНК.

Терминация

Факторы терминации:
RF-1
вызывает отделение полипептидной цепи при считывании кодонов UAA и UAG;
RF-2
действует аналогичным образом при считывании UAA и UGA,
EF-3 может облегчить работу двух других факторов.
Этапы терминации трансляции:

1. В А-участке оказывается один из трех терминирующих кодонов – UAG, UAA или UGA. Из-за отсутствия тРНК, отвечающих этим кодонам,полипептидил-тРНК остается связанной с Р-участком.

2. RF-1 и RF-2 катализируют отсоединение полипептидной цепи от тРНК, отделение их обоих от рибосомы, а 70S-рибосомы – от мРНК.
RF-1 узнает в А-участке кодон UAA или UAG; RF-2 включается в том случае, когда в А-участке оказы-вается UAA или UGA;
RF-3 облегчает работу двух других факторов. Если терминирующим кодономявляется UAA, то эффективность процесса терминации оказывается наибольшей, поскольку этот кодон узнают оба фактора – RF-1 и RF-2. Однако, каким бы из стоп-кодонов ни обеспечивалась терминация,ее эффективность зависит от фланкирующих эти кодоны последовательностей в мРНК.

Когда расстояние от рибосомы до сайта инициации достигнет величины 100–200 нуклеотидов, в этом сайте может произойти новая инициация трансляции. Таким образом на одной мРНК
может находится несколько транслирующих рибосом - полирибосомы (рис)

Рибосомы

Характерискика рибосом

Рибосомы
эукариот
: 80S, размер - 22x32 нм,
M ~4.5 млн.Да состоит из двух субъединиц.

Большая субъединица
М=3.0млн.Да, 60S
[1rRNA 5S (~120н), 1рРНК 5.8S (~160н), 1rRNA 28S (4800н),
45-50 белковых молекул].
Малая субъединица
М=1.5 млн.Да, 40S [1rRNA18S (1900н), 30-35
белковые молекулы].

В цитоплазме эукариотической клетки содержится ~10 млн. рибосом
эукариотического типа.

Рибосомы прокариот:
70S, размер - 21x29 нм, М ~2.8 млн.Да,
состоит из двух субъединиц.

Большая субъединица М=1.8млн.Да 50S
[1rRNA 23S(~2904н), 1rRNA 5S(~120н), 34 белковые молекулы
(L1-L34)].

Малая субъединица М=1.0млн.Да 30S
[1rRNA 16S (~1542н), 21 белковые молекулы (S1-S21)].

В клетке E.coli содержится ~15тыс. рибосом, что составляет
– 1/4 сухой массы клетки. Рибосомы прокариотического типа
присутствуют в митохондриях и пластидах эукариот.

Малые и большие субъединицы могут диссоциировать на составляющие
РНК и белки и самособираются при определенных условиях.

Строение рибосом

Рибосома имеет два участка для связывания тРНК:

Р-центр
(пептидил-тРНК-связывающий центр)
-
связывание тРНК присоединенной к растущей полипептидной
цепи.

А-центр
(аминоацил-тРНК-связывающий участок)
-
связвает тРНК несущую следующую добавляемую аминокислоту,
располагается на большой субъединице рибосомы.

Аcn
центр

пептидилтрансфераза
образует пептидные связи между актами, прочно связывается
с рибосомой.

рибосома
р эукариот 22x32 нм, M~4.5 млн.Да 80S. Большая субъед М=3.0млн.Да, 60S [1rRNA 5S (~120н), 1рРНК 5.8S (~160н), 1rRNA 28S (~5 тыс.н), ~45 белков]; малая субъед М=1.5 млн.Да, 40S.
1rRNA18S (~2 тыс.н),~33 белка] | в цитоплазме Eu ~10 млн.р эукариотич типа |
р прокариот: 21x29 нм, М ~2.8 млн.Да, 70S | большая субъед М=1.8млн.Да 50S[1RNA 23S(~3200н), 1rRNA 5S(~120н), 34белка]; малая субъед М=1.0млн.Да 30S[1rRNA 16S (~1600н), 21 белок] | E.coli ~15тыс р – 1.4 сухой m кл | р прокариотич типа присут в митох и пластидах Eu |
| P-центр пептидил-тРНК-связывающий центр, А-центр большой субъед. р – аминоацил-тРНК-связывающий участок, Аcn центр | пептидилтрансфераза – образ. пептидные связи м-у актами, прочно связан с р | р прокариот мельче и сод меньше компонентов
мРНК [кэп | 5’-НТО | AUG | транслируемая область | стоп 3’-НТО | поли(А)]
инициация сканирование РНК малой субъединицой рибосомы | связывание со стартовым (инициирующим) кодоном AUG-5’ конца – сборка рибосомы | инициаторный комплекс, факторы инициации | Первой к мРНК присоед малая субъед. р связанная с инициаторной-тРНК узнающей AUG и несущей метионин. Процесс катализируется фактором инициации 2 IF2 – фосфорилирование одной из трех его субъед. снижает активность ф-та – контроль белкогого синтеза (незрелые эритроциты) | элонгация 5’?3’ | транслокация – возвращение пустой тРНК в цитоплазму | транслокация рибосомы вдоль мРНК сопровожд. конформационными изменениями с затратой энергии GTP (4GTP вцелом на 1 пепт. связь) | кодон мРНК спаривается с антикодоном тРНК | карбоксильный конец растущего полипептида связан ковалентно с тРНК – пептидил-тРНК | образ. полисомы | терминирующий кодон (стоп-кодон) UAA, UAG, UGA – диссоциация рибосомы – терминация | фактор освобождения-белок связ с стоп-кодоном и меняет активность пептидилтрансферазы кот присоед к пептидил-тРНК Н2О и полипептид отделяется от тРНК и выходит из р | Цикл элонгации составляет 1/20 сек – белок в 300 акт синтезируется за 20 сек Ecoli

Литература: 

К сожалению, список литературы отсутствует.

Транспортная РНК

70-90Н | вторичная стр-ра- клеверный лист | CCA 3' const для всех tRNA |к концевому аденозину присоед акта |
наличие тимина, псевдоуридина-пси, дигироуридина ДГУ в D-петле - защита от рибонуклеаз ? долгоживущие | Разнообразие первичных структур tРНК - 61+1 - по кол-ву кодонов + формилметиониновая tРНК, у кот антикодон такой же, как у метиониновой tРНК. Разнообразие третичных структур - 20 (по кол-ву аминокислот) | рекогниция - образование ковалентной связи м-у tРНК и актой | аминоацил-тРНК-синтетазы присоединяют акты к тРНК

Функция тРНК заключается в переносе аминокислот из цитоплазмы в рибосомы, в которых происходит синтез белков.
тРНК связывающие одну аминокислоту называются изоакцепторными.
Всего в клетке одновременно существует 64 различных тРНК.
Каждая тРНК спаривается только со своим кодоном.
Каждая тРНК распознает свой собственный кодон без участия аминокислоты. Связавшиеся с тРНК аминокислоты химически модифицировали, после чего анализировали получившийся полипептид, который содержал модифицированную аминокислоту. Цистеинил-тРНКCys (R=CH2-SH) восстанавливали до аланил-тРНКCys (R=CH3).
Большинство тРНК, не зависимо от их нуклеотидной последовательности, имеют вторичную структуру в форме клеверного листа из-за наличия в ней трех шпилек.

Особенности структуры тРНК

На 3'-конце молекулы всегда находятся четыре неспаренных нуклеотида, причем три из них – это обязательно ССА. 5'- и 3'-концы цепи РНК образуют акцепторный стебель. Цепи удерживают-ся вместе благодаря комплементарному спарива-нию семи нуклеотидов 5'-конца с семью нуклеотида-ми, находящимися вблизи 3'-конца. 2. У всех моле-кул имеется шпилька T?C, обозначаемая так пото-му, что она содержит два необычных остатка: рибо-тимидин (Т) и псевдоуридин (?). Шпилька состоит из двухцепочечного стебля из пяти спаренных осно- ваний, включая пару G-C, и петли длиной семь нуклеотидов. Тринуклеотид Т?С всегда расположен
в одном и том же месте петли. 3. В антикодоновой шпильке стебель всегда представлен семью спарен-
ными основаниями. Триплет, комплементарный родственному кодону,– антикодон – находится в пет-
ле, состоящей из семи нуклеотидов. С 5'-конца антикодон фланкируют инвариантный остаток ура-
цила и модифицированный цитозин, а к его 3'-концу примыкает модифицированный пурин, как правило
аденин. 4. Еще одна шпилька состоит из стебля длиной три-четыре пары нуклеотидов и петли варь-
ирующего размера, часто содержащей урацил в вос-становленной форме – дигидроурацил (DU). Наиболее сильно варьируют нуклеотидные по-следовательности стеблей, число нуклеотидов меж-ду антикодоновым стеблем и стеблем Т?С (вариа-бельная петля), а также размер петли и локализация остатков дигидроурацила в DU-петле.
[Сингер, 1998].

Третичная структура тРНК

L-образная структура.

Присоединение аминокислот к тРНК

схема присоединения аминокислоты к тРНКДля того чтобы аминокислота могла образовывать полипептидную цепь она должна присоединиться к тРНК с помощью фермента аминоацил-тРНК-синтетазы. Этот фермент образует ковалентную связь между карбоксильной группой аминокислоты и гидроксильной группой рибозы на 3’-конце тРНК при участии АТФ. Аминоацил-тРНК-синтетаза узнает специфический кодон не из-за наличия антикодона на тРНК, а по наличию специфического сайта узнавания на тРНК.
Всего в клетке имеется 21 различных аминоацил-тРНК-синтетаз.
Присоединение происходит в две стадии:
1. Карбоксильная группа аминокислоты присоединяется к а-фосфату АТФ. Полученный нестабильный аминоацил-аденилат стабилизируется связываясь с ферментом.
2. Перенос аминоацильной группы аминоацил-аденилата на 2’ или 3’-OH-группу концевой рибозы тРНК
Некоторые аминоацил-тРНК-синтетазы состоят из одной полипептидной цепи, другие – из двух или четырех идентичных цепей, каждая молекулярной массой от 35 до 115 кДа. Некоторые димерные и тетрамерные ферменты состоят из субъединиц двух типов. Четкой корреляции между размером молекулы фермента или характером его субъединичной структуры и специфичностью не существует.
Специфичность фермента определяется его прочным связыванием с акцепторным концом тРНК, DU-участком и вариабельной петлей. Некоторые ферменты, по-видимому, не распознают антикодоновый триплет и катализируют реакцию аминоацетилирования даже при измененном антикодоне. Однако отдельные ферменты проявляют пониженную активность по отношению к таким модифицированным тРНК и при замене антикодона присоединяют не ту аминокислоту.

70-90н | вторичная стр-ра- клеверный лист | CCA 3' const для всех tRNA |к концевому аденозину присоед акта |
наличие тимина, псевдоуридина-пси, дигироуридина ДГУ в D-петле - защита от рибонуклеаз ? долгоживущие | Разнообразие первичных структур tРНК - 61+1 - по кол-ву кодонов + формилметиониновая tРНК, у кот антикодон такой же, как у метиониновой tРНК. Разнообразие третичных структур - 20 (по кол-ву аминокислот)

Имеются два вида тРНК связывающие метионин тРНКFMet и тРНКMMet у прокариот и, тРНКIMetи тРНКMMet - у эукариот. К каждой тРНК добавляется метионин с помощью соответствующих аминоацил-тРНК-синтетез. метионин присоединенный к тРНКFMet и тРНКIMet формилируется ферментом метионил-тРНК-трансформилазой до Fmet-тРНКFMet. тРНК нагруженные формилметионином узнают инициаторный кодон AUG.

Литература: 

К сожалению, список литературы отсутствует.

Геликазы

ДНК геликазы - ферменты раскручивающие двуцепочечную спираль ДНК с затратой энергии гидролиза трифосфатов NTP. Образуемая одноцепочечная ДНК участвует в различных процессах, таких как репликация, рекомбинация, и репарация. ДНК геликазы необходимы для репликации, репарации, рекомбинации и транскрипции. Геликазы присутствуют во всех организмах.
При нарушении работы геликаз в клетках могут возникать различные заболевания: xeroderma pigmentosum, Cockayne's syndrome, Bloom's syndrome, Werner's syndrome.

ДНК-геликазы разделяют на несклько семейств:
Супепсемейство I: UvrD (E. coli, DNA repair), Rep (E. coli, DNA replication), PcrA (Bacillus stearothermophilus, role not precisely known), Dda (bacteriophage T4, replication initiation).
Суперсемейство II: RecQ (E. coli, DNA repair), BLM (human, DNA repair), WRN (human, DNA repair), NS3[1] (Hepatitis C virus, replication). TRCF (Mfd) (E.coli, transcription-repair coupling factor).
Суперсемейство III: LTag (Simian Virus 40, replication), E1 (human papillomavirus, replication).
DnaB-like family: DnaB (E. coli, replication), gp41 (bacteriophage T4, DNA replication), T7gp4 (bacteriophage T7, DNA replication).
Rho-like family: Rho (E. coli, Transcription termination factor ).
Геликаза бактериофага T7

Первая кристаллическая структура была получена для геликазы PcrA. Эта геликаза имеет несколько структурных доменов, включающих два домена АТФазы схожих с доменами рекомбинационной геликазы RecA.
Кольцевые геликазы часто содержат домены дополнительные к доменам геликазной активности. Например, T7 гена 4 белок имеет раздельные домены геликазы и праймазы.
рис. трехмерная структура гексамера геликазы бактериофага T7 гена 4.
Особенностью структуры геликазы является ассиметрия гексамерного кольца. Эта асимметрия необходима для работы фермента.

рис. Трехмерная структура геликазного гексамера. Нажмите на рисунок, чтобы увидеть работу геликазы. Движение молекул белка во время связывания ДНК, гидролиза и освобождения ДНК (сами нуклеотиды не показаны).

Регуляция экспресии

Регуляция экспресии

Белковые домены связывающие ДНК

Инсуляторы

ins.GIF

Интерференция РНК

Интерференция РНК – феномен, ведущий к посттранскрипционному молчанию генов (PTGS2).
Явление RNA interference (RNAi3) обнаружено Fire et al. в 1998 году у нематоды C.elegans. Было обнаружено, что введение двухцепочечной РНК (dsRNA1) в нематоду приводит к замолканию генов гомологичных введеной
dsRNA1 и образование малых РНК (siRNAs4). Позже выяснилось, что этот феномен широко распространен среди большинства организмов, включая простейших, животных и растений. Интерференция РНК заключается в разрезании dsRNA1 на короткие, ~20 нуклеотидов, фрагменты, которые выполняют роль матрицы для узнавания комлементарных РНК и разрезания их на фрагменты.

Механизм
Механизм RNAi3 заключается в расщеплении двухцепочечной РНК на 21-23 пн фрагменты, которые действуют как матрица для разрушения гомологичных последовательностей РНК. Причем было установлено, что длинные dsDNA более активны чем короткие.
Попавшая в клетку dsRNA1 узнается белком Dicer, осуществляющим разрезание длинных
двухцепочечных РНК на короткие фрагменты. Далее такие дуплексы РНК с 2-3 нуклеотидными липкими концами, полученные Dicer связываются с белковым комплексом RISC (RNA-induced silencing complex), осуществляющим разрезание комплементарных одноцепочечных РНК в месте узнавания, что исключает трансляцию этих РНК. РНК разрезается в середине места узнавания, примерно 12 пн от 3'конца siRNA4. Эта позиция соответствует одному обороту двуцепочечного дуплекса РНК разрезающей и РНК которая разрежется. Вирусный белок Hc-Pro ингибирует действие комплеков RNAi3. (рис1.).
Dicer - АТФ-азная рибонуклеаза - инициатор сайленсинга, разрезает исходную dsRNA1, для матрицы. Имеется геликазный домен, С-концевой сегмент связывания с РНК и РНКазныйIII. Мышиный Dicer М=215 кДа и длиной 1373 аминокислоты расположен на конце 12 хромосомы и экспрессируется в различные фазы развития от эмбриональной
до взрослого состояния. Человеческий Dicer имеет массу 218 кДа.
RISC - мультибелковый комплекс ~500кДа, состоящий из нуклеиновых кислот и белков. Одна из субъединиц - Argonaute-2.
Длина некоторых интронов после процесcинга составляет ~20 нуклеотидов, что может указывать на участие их в механизме RNAi3.



рис1. dsRNA1 проникшая в клетку узнается Dicer при помощи вспомогательных факторов RDE-1, RDE-4 и разрезается на фрагменты ~20 пн. siRNAs44. Фрагменты связываются с белковым комплексом RISC, который узнает и разрезает мРНК. Оставшийся одноцепочечный фрагмент может связываться с мРНК и служить затравкой для РНК-зависимой РНК-полимеразы (RdRP), которая достраивает мРНК до двухцепочечного
состояния, которое вновь узнается белком Dicer. И так происходит до тех пор, пока вся чужеродная мРНК не уничтожится. (Bantounas at al., 2004) Функции в клетке.
Защита от вирусов.
Интерференция РНК служит для защиты от проникновения в клетку молекулярных паразитов, таких как геномная РНК некоторых вирусов, состоящая из двух антипараллельных молекул. При запуске механизма RNAi3 такие дуплексы служат матрицей для последующего разрушения молекул РНК, с которых будут синтезированы вирусные белки. Однако вирусы не стояли на месте и приобрели способность противостоять клеточной защите. Вирусный белок Hc-Pro ингибирует работу белковых комплексов вовлеченных в механизм RNAi3.
Контроль активности транспозонов.

Так же RNAi3 служит для контролирования активности мобильных элементов. Мобильный элемент, или транспозон, это участок внутри ДНК какого-либо организма способный к копированию самого себя и встраиванию в любую часть генома. Если бы все транспозоны в клетке находились в активном состоянии они начали бы беспорядочно встраиваться в некодирующие участки генома, что может быть не так страшно, и в кодирующие участки, что неминуемо привело бы к нарушению работы генов и гибели организма. Предполагается, что механизм RNAi3 препятствует активации транспозонов и расселению их по геному. Таким образом, взаимодействие RNAi3 и транспозонной активности участвует в формировании структуры геномов большинства организмов. Считается, что транспозоны могут быть предками ретровирусов встроившихся когда-то в геном и существующими как внутренние паразиты. Из вышесказанного следует, что RNAi3 служит защитой
как с внешней стороны - вирусы, так и с внутренней - транспозоны.
Метилирование ДНК
RNAi3-зависимое метилирование ДНК - известный феномен у растений. Ранние наблюдения специфического метилирования ДНК, зависящего от репликации РНК, у растений описаны Wessenegger et al. (1994). Эта работа демонстрирует, что метилируются короткие районы ~30 пн, когда присутствует гомологичная РНК. При действии вирусного белка Hc-Pro, ингибирующего RNAi3, метилирование районов уменьшается. При метилировании ДНК, способность присоединять гистон ацетилазу уменьшается, что мешает разрыхлению хроматина и, соответственно, транскрипции генов. Модификации ДНК, полученные таким образом, могут наследоваться и передаваться дочерним клеткам, что может явиться механизмом клеточной памяти и регуляции развития организма.

Использование
в исследованиях.

Интерференция РНК используется исследователями для анализа функций различных генов. Если необходимо исключить из клетки какой-либо белок или несколько белков, исследователь может инъецировать двуцепочечные фрагменты РНК, комплепментарные участку мРНК, и механизм RNAi3 удалит мРНК и предотвратит их трансляцию. Это можно проделывать на различных этапах клеточного цикла. Такой подход называется генным нокдауном. Например, таким способом было систематически инактивировано 5690 генов C.elegans для определения генов, регулирующих продолжительность жизни. В результате эксперимента был обнаружен ген митохондриальной лейцил-тРНК-синтетазы и показано, что мутации этого гена остлабляют работу митохондрий и увеличивают продолжительность жизи. Было предположено, что это результат уменьшения уровня АТФ и потребления кислорода. Введение конструкций, экспрессирующих РНК, содержащую инвертированные повторы. Такой механизм, вероятно, может происходить и в
естественных условиях.

Лечение заболеваний.
Существует два основных нарушения при развитии рака. Первое, это нарушение клеточного цикла, результатом которого является ненормальный рост клеток, и второе это потеря чувствительности к белкам вызывающим апоптоз, или клеточную смерть.
RNAi3 может быть использована для лечения рака. Для этого можно создать нокдаун генов ответственных за клеточный цикл и противоапоптозных генов в клетках опухоли. Для избирательного действия на раковые клетки можно использовать RNAi3, вводя уникальные последовательности dsRNA1, специфичные для какого-нибудь определенного гена, или вводя их непосредственно в опухоль.
Недавние исследования ясно показали продвинутость метода RNAi3 в подавлении роста и разрушении раковых клеток. Предпринимаются успешные попытки
введения вирусных векторов в раковые клетки, что так же способствует подавлению их роста. Однако все эти методы лечения находятся пока на предклинических испытаниях.
Болезни, вызванные вирусами и бактериями, продолжают являться основной причиной смертности людей в мире и продолжают вызывать беспокойство возможностью появления новых форм опасных заболеваний и использование их террористами. В настоящее время ВИЧ достиг эпидемических показателей в африканских странах и продолжает являться важной причиной смертности среди гомосексуалистов и наркоманов.
Способность RNAi ингибировать репликацию вирусов и других инфицирующих агентов была продемонстрирована на клеточных культурах и подает надежды на лечение этих заболеваний.

Литература: 
  1. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806-811
  2. Sharp RNA interference-2001 Genes and Development Vol. 15, No. 5, pp. 485-490, March 1, 2001
  3. S. Mattick, M.J. Gagen The Evolution of Controlled Multitasked Gene Networks: The Role of Introns and Other Noncoding RNAs in the Development of Complex Organisms John Molecular Biology and Evolution 18:1611-1630 (2001)
  4. I Bantounas, L A Phylactou and J B Uney RNA interference and the use of small interfering RNA to study gene function in mammalian systems Journal of Molecular Endocrinology (2004)

Энхансеры и супрессоры

Энхансеры - участки вне промотора, которые связываются с различными факторами транскрипции и способны усиливать транскрипцию определенных генов.
Энхансеры могут располагаться в облости от промотора до 10000 пн от него (энхансер SV40) перед, после промотора или пределах интрона.
Некоторые гены контролируются более чем одним энхансером (Drosophila even-skipped ген)
Регуляторные элементы дрожжей S.cerevisae называются UAS (upstream activating sequences) функционально схожи с энхансерами высших эукариот. Большинство генов S. cerevisae имеют один UAS, который лежит в пределах нескольких сотен пн от кэп-сайта промотора.

Рекомбинация ДНК

Рекомбинация ДНК

Гомологичная рекомбинация

Общая рекомбинация при согласованном внесении разрывов и воссоединении цепей двух спиралей ДНК с образованием протяженных гетеродуплексных областей. Чтобы могла произойти рекомбинация между двойными спиралями, представленная на, каждая из четырех цепей должна быть разорвана и затем соединена с новым партнером. Соответствующие цепи обоих линейных гомологичных дуплексов ДНК надрезаются и свободные концы одной спирали спариваются с комплементарными участками другой. Перекрест стабилизируется сшиванием концов донорных цепей со свободными концами реципиентных спиралей. Точка перекреста обменивающихся цепей перемещается вдоль спиралей – процесс, называемый миграцией ветви (е). При этом происходит одновременное расхождение цепей исходных спиралей и их реассоциация с новыми партнерами с образованием дочерних дуплексов. Структуры д и е, а также ж называются структурами Холлидея по имени исследователя, впервые их
предложившего. Структуры Холлидея могут переходить в рекомбинантные двойные спирали путем внесения разрыва и воссоединения цепей двумя альтернативными способами. Один способ состоит в разрезании и воссоединении перекрещивающихся цепей. Два реципрокных продукта л и м могут образоваться, если разрыв и последующее воссоединение цепей произойдут в точке перекреста в структурах е и д или по линии пересечения четырех цепей в изомерной структуре Холлидея и. Размер обменивающихся фрагментов зависит от расстояния, на которое произошла миграция ветви до акта рекомбинации. Альтернативные продукты н и о образуются в том случае, если структура Холлидея з переходит в результате разрыва в к. В основе рекомбинации данного типа лежит гомологичное спаривание цепей, принадлежащих двум разным спиралям ДНК, поэтому скорее всего она произойдет в том месте, где такое спаривание возможно a priori и где гомологичность последова тельностей достаточно велика, чтобы могла произойти миграция
ветви в рамках структуры со скрестившимися цепями. Отсюда можно понять, почему общая, или гомологичная, рекомбинация происходит также между двумя повторами в пределах одной молекулы ДНК или между аллельными и неаллельными элементами одной и той же последовательности в двух разных хромосомах.
В ходе миграции ветви при спаривании цепей,принадлежащих разным спиралям, образуются гетеродуплексы. В таких гетеродуплексах в пределах сегмента между сайтом начала образования структуры Холлидея и сайтом кроссинговера может содержаться по одному или более ошибочно спаренных оснований. Они удаляются так же, как любые модифицированные основания при репарации ДНК. Однако, поскольку удалено может быть любое из ошибочно спаренных оснований, в обеих рекомбинантных спиралях в данном сайте могут оказаться одинаковые пары оснований, т.е. рекомбинация для этого сайта окажется нереципрокной . Таким образом, каждая из рекомбинантных спиралей может быть похожа на любой
из начальных дуплексов в тех позициях, где исходно они различались.

Общая рекомбинация с образованием двухцепочечного разрыва.
Альтернативный механизм общей рекомбинации включает образование двухцепочечного разрыва в одном из дуплексов-партнеров. Далее с помощью экзонуклеаз в месте разрыва образуется брешь. При спаривании 3'-одноцепочечного конца бреши с комплементарной цепью интактной спирали в последней образуется петля. Размер этой петли увеличивается по мере того, как ДНК-полимераза наращивает 3'-конец «вклинившейся» цепи. В итоге другой одноцепочечный конец бреши спаривается с комплементарной последовательностью в перемещающейся петле. В результате такого спаривания образуется система «праймер матрица», и ДНК-полимераза синтезирует недостающую цепь, заполняя брешь. Лигирование двух растущих концов с исходными цепями приводит к образованию двойной структуры Холлидея (т.е. структуры, в которой две спирали объединены двумя перекрестами,
по одному на каждом конце бреши). Миграция ветви в одном или обоих перекрестах передвигает оба места сцепления в любом направлении, при этом в участках, фланкирующих брешь, могут возникать ошибки. Разделение таких структур может идти двумя способами – с перекрестом и без него , с образованием четырех дуплексов.
Необходимо отметить некоторые особенности этого механизма. Образование ошибочных пар (гетеродуплексов) в районах, фланкирующих брешь, обусловливает получение как реципрокных, так и нереципрокных рекомбинаций между генетическими маркерами. Если двухцепочечный разрыв происходит вблизи (или в пределах) участка, где между спиралями имеются различия (замены оснований, делеции, вставки, инверсии и т.п.), то рекомбинанты унаследуют нуклеотидную последовательность
партнера, у которого разрыва не происходило. Этот механизм объясняет многие случаи генной конверсии, особенно те, в которых протяженная последовательность одного дуплекса замещается соответствующей, но отличающейся последовательностью другого
дуплекса.
Нереципрокная общая рекомбинация используется и при репарации некоторых повреждений ДНК. Например, если тиминовые димеры не были удалены из УФ-облученной ДНК до того, как к ним подошла репликативная вилка, то синтез комплементарной цепи в этом участке не может быть завершен. Поскольку тиминовые димеры, находящиеся напротив бреши, не могут быть вы-
щеплены, остается один путь для спасения хроматиды – использовать генетическую информацию гомологичной сестринской хроматиды и заполнить брешь. Для этого применяется такой же механизм, как для репарации брешей.
в.

Ферменты, участвующие в общей рекомбинации.

В общей рекомбинации участвуют два специфических фермента и еще несколько ферментов, катализирующих также процессы репликации и репарации ДНК. Энзимология общей рекомбинации изучена только для некоторых прокариотических организмов, в частности E. coli и ее фагов. Один из специфических ферментов, необходимых для успешной гомологичной рекомбинации, называется recА-белком.
Он катализирует обмен одиночными цепями, используя энергию гидролиза АТР до ADP и неорганического фосфата. RecA-зависимое внедрение одноцепочечных ДНК в дуплекс – первый этап рекомбинационного процесса в рамках обеих схем Холлидея и механизма с образованием двухцепочечных разрывов. Второй фермент, состоящий из трех отдельных субъединиц (В, С и D) и поэтому называемый recBCD-нуклеазой, обладает эндо- и экзонуклеазной, а также геликазной активностями. Механизм его действия до конца не установлен, однако известно, что
recBCD-нуклеаза индуцирует разрывы в дуплексной ДНК и благодаря присущей ей геликазной активности вместе с recА инициирует рекомбинационный.
Идентифицирован также фермент, разрезающий узлы в структурах Холлидея; при его участии образуются липкие концы, соединяемые лигазой. В общей рекомбинации участвуют также геликазы и белки, связывающиеся с одноцепочечной ДНК
(SSB; от англ. single strand binding); оба они необходимы для обеспечения процесса миграции ветви.

Как известно, перемещению цепей во время миграции ветви способствует Pol I, а в воссоединенииразорванных цепей участвует ДНК-лигаза. Для снятия топологических ограничений при раскручивании спирали и для раcпутывания перекрученных структур, по-видимому, нужны топоизомераза типа I и, возможно, гираза.

Гомологичная рекомбинация в репарации ДНК

Быстро делящиеся бактериальные клетки, содержащие несколько репликонов, образованных недореплицированными хромосомами, более устойчивы к действию ионизирующей радиации, которая индуцирует двухцепочечные разрывы ДНК, чем клетки с небольшим числом репликонов, находящиеся в стационарной фазе.
Гаплоидные клетки дрожжей в фазе G1 перед началом синтеза ДНК чрезвычайно чувствительны к действию ионизирующей радиации, тогда как те же клетки в фазе G2 перед митозом так же устойчивы к ионизирующему излучению, как и диплоидные клетки.
Эти факты указывают на то, что для эффективного исправления
повреждений, вызываемых ионизирующей радиацией, необходимо одновременное присутствие в клетке двух гомологичных молекул ДНК.

рис.1 Одна из моделей объясняющих репарацию двуцепочечных разрывов.
Процесс репарации условно разделяется на три этапа:
1. Пресинаптическая фаза - происходит внесение двухцепочечного разрыва в ДНК или, при его наличии, сразу осуществляется нуклеазное расщепление концов разрыва. В создании одноцепочечных 3’-OH-выступающих концов ДНК в месте разрыва принимает участие белок RecBCD, который обладает как геликазной, так и экзонуклеазной активностями. RecBCD расплетает двухцепочечную молекулу ДНК в месте разрыва и гидролизует одну из цепей в направлении 5’>3’, оставляя выступающий одноцепочечный участок.
2. Синаптическая фаза - происходит синапсис гомологичных участков двух молекул ДНК с вхождением комплементарного
одноцепочечного участка в ДНК-дуплекс и последующим репаративным синтезом ДНК. Поиск гомологичных участков и обмен цепями, необходимые для рекомбинации, происходят с участием белка RecA.
3. Постсинаптическая фаза - образовавшиеся структуры Холидея разделяются с помощью белков RuvA, -B и -C, RecG, а также белков SOS-системы репарации (RecN, UvrD, RecF и RecJ). Похожие механизмы используются клетками для рекомбинационной репарации одноцепочечных брешей, остающихся в молекулах ДНК из-за блокировки репликативного синтеза ДНК модифицированными нуклеотидами.

Многие продукты генов E. coli и дрожжей, участвующие в рекомбинационной репарации повреждений ДНК, имеют гомологи у животных и человека. Отличительной особенностью эукариотической рекомбинации и репарации является вхождение соответствующих белков в многочисленные белковые комплексы, в частности транскриптосомы и реплисомы, что
указывает на их важную роль в матричном биосинтезе нуклеиновых кислот эукариотических клеток.

Сайт-специфическая рекомбинация

Механизм сайт-специфической рекомбинации

Сайт-специфическая рекомбинация происходит между специфическими сегментами дуплексов ДНК, не имеющими протяженных гомологичных участков. Характерным примером такой рекомбинации служит встраивание кольцевой ДНК фага λ в хромосому Е. coli и ее обратное выщепление. Рекомбинация происходит в пределах специфической нуклеотидной последовательности ДНК фага λ (attP-сайт) и уникальной последовательности ДНК Е. coli (аttВ-сайт). Нуклеотидные последовательности attP- и attВ-сайтов совершенно различны, хотя имеют общее ядро (О) протяженностью в 15 нуклеотидных пар. AttP (POP') простирается на 150 нуклеотидов влево (Р) и на 75 нуклеотидов вправо (Р') от общего ядра, a attB (BOB') – это сегмент длиной всего около 25 нуклеотидов, включая и ядро. Поскольку нуклеотидные последовательности, фланкирующие attP- и attВ-сайты слева (attL) и справа (attR), для этих сайтов различаются, механизм рекомбинационного выщепления ДНК фага λ из ДНК Е. coli должен отличаться от механизма их рекомбинационной интеграции. И действительно, для рекомбинации между attL и attR при исключении фаговой ДНК помимо белка Int необходимы фаговый белок xis и клеточный белок HF. Процесс рекомбинационного выщепления, по-видимому, имеет некоторое сходство с процессом интеграции, но роль указанных трех белков, особенно белка xis, все еще изучается.

Случайная рекомбинация

Негомологичная рекомбинация. Рекомбинация между негомологичными нуклеотидными последовательностями происходит в клетках прокариот и дрожжей достаточно редко, а в клетках млекопитающих – весьма часто. К негомологичной рекомбинации можно отнести процесс случайного встраивания вирусной или плазмидной ДНК в ДНК клеток животных, в результате чего в реплицирующихся
геномах паповавирусов появляется множество делеций и дупликаций. Концы разорванной ДНК могут соединиться, даже если они негомологичны. В некоторых случаях рекомбинация происходит между последовательностями, содержащими несколько гомологичных пар оснований, или между короткими частично гомологичными участками. Но, как правило, рекомбинирующие сегменты не имеют гомоло-
гичных последовательностей.

Репарация ДНК

Репарация ДНК

Общие сведения

Агенты повреждающие ДНК

Излучение

1. ионизирующая радиация (гамма лучи, рентгеновские лучи)

2. Ультрафиолетовое излучение (особенно ~260 нм, именно в этой области происходит максимальное поглощение ДНК)

Активные радикалы кислорода образуемые во время нормального клеточного дыхания в различных биохимических путях.
Химические вещества окружающей среды.

Многие углеводороды.

Химикаты используемые в противоопухолевой химотерапии.

Типы повреждений ДНК

1. Все четыре основания в ДНК (A, T, C, G) могут быть ковалентно модифицированы в различных положениях.
Наиболее частое - это потеря аминогруппы (дезаминирование) — в таком случае C превращается в U.
Неправильное включение оснований происходящее из-за ошибок в работе ДНК полимераз при репликации.
Наиболее часто происходит включение урацила вместо тимина.
Нарушения структуры.
В ДНК могут происходить разрывы. Разрывы могут быть одноцепочечные, или могут разорваться обе цепи ДНК.

Ионизирующая радиация может быть частой причиной таких разрывов.
Между соседними основаниями может образоваться ковалентная связь, причем связь может образоваться между соседними основаниями в одной цепи или между двумя цепями ДНК.
типы повреждения ДНК
изменение одного основания
апуринизация
замена С на У
замена А на гипоксантин
алкилирование основания
вставка или делеция нуклеотида
встраивание аналогичного основания
изменение двух оснований
образование тиминовых димеров
поперечная связь с бифункиональным алкилирующим агентом
разрушение цепи
ионизирующее излучение
радиоактивное разрушение элементов остова
поперечные связи
между основаниями одной нити или двух параллельных нитей
между ДНК и белковыми молекулами, например гистонами


Репарация поврежденных оснований

Поврежденные основания могут быть исправлены различными путями:
Прямое химическое исправление повреждений.

Эксцизионная репарация (ER), при которой поврежденное основание удаляется и заменяется новым. Имеется три модели эксцизионной репарации, в каждой из которых используется свой собственный набор ферментов.
Эксцизионная репарация оснований (BER).
Эксцизионная репарация нуклеотидов (NER).
Мисмэтч репарация(MMR).


Прямое исправление повреждений.

Наиболее частая причина точечных мутаций у человека - это спонтанное добавление метильной группы - один из типов алкилирования. Такие модификации исправляются ферментами называемыми гликозилазами, исправляющими ошибку без разрушения цепи ДНК.

Некоторые препараты используемые в химотерапии также повреждают ДНК путем алкилирования.
Проблема репарации состоит в том, что ограниченным набором ферментов и механизмов клетка должна справиться со многими повреждениями вызванными самыми различными химическими и физическими агентами.

Эксцизионная репарация оснований (BER)

Основные ключевые события:

1. Удаления поврежденного основания (происходит ~ 20,000 раз в день в каждой клетке человеческого тела) ДНК гликозилазими. У человека имеется по крайней мере 8 генов кодирующих различные ДНК гликозилазы, кадждые из которых распознают свой набор повреждений оснований.
2. Удаление дезоксирибофосфата приводит к образованию пустоты в ДНК.
3. Замена правильным нуклеотидом. Это функция у человека выполняется ДНК полимеразой бетта.
4. Лигирование разрыва цепи. Имеется два фермента, оба нуждаются в АТФ.


Эксцизионная репарация нуклеотидов (NER)

NER отличается от BER несколькими путями.
Использованием различных ферментных систем.
Даже если ошибка в одном нуклеотиде, удаляется сразу множество нуклеотидов в районе повреждения.

Основные ключевые события NER:
1.Повреждение распознается одним или несколькими факторами связывающимися с местом повреждения.
2. ДНК раскручивается в месте повреждения. В этом процессе участвуют
различные транскрипционные факторы IIH, TFIIH, (которые так же работают при нормальной транскрипции).
3. Разрез ДНК происходит с 3' и 5'-конца от повреждения, в результате чего удаляется фрагмент ДНК содержащий поврежденный нуклеотид.
4. Новая цепь ДНК достраивается по матрице неповрежденной цепи ДНК полимеразами дельта или эпсилон.
5. Лигазы сшивают вновь синтезированный конец цепи.

Пигментная ксеродерма (XP)
XP редкое наследственное заболевание человека проявляющееся в поражении кожи при облучении светом, что в конечном итоге приводит к развитию рака кожи и гибели больного.
Болезнь возникает из-за мутаций в генах участвующих в NER репарации. Например:
XPA кодирует белок связывающийся с местом повреждения и помогающий сборке репарирующего комплекса.
XPB и XPD, которыя являются частями транскрипционного фактора TFIIH. Некоторые мутации в XPB и XPD также могут являться причиной преждевременного старения.
XPF разрезает цепь ДНК с 5'-конца от повреждения.

XPG разрезает цепь с 3'-конца.

Мисмэтч репарация(MMR)

Мисмэтч репарация исправляет ошибочно встроенные неповрежденные основания которые не образуют нормальное Уотсон-Криковское спаривание (A•T, C•G). Такие ошибки происходят во время работы ДНК полимеразы при репликации.
В мисмэтч репарации участвуют ферменты вовлеченные как в BER, так и в NER репарацию, так и специализированные ферменты.
Синтез ДНК при мисмэтч репарации осуществляется ДНК полимеразами дельта или эпсилон.
Система мисмэтч репарации участвует в увеличении точности рекомбинации при мейозе.

Репарация разрывов ДНК

Ионизирующая радиация и некоторые химические вещества способны разорвать одну или две цепи ДНК.
Одноцепочечные разрывы (SSB)
Разрывы одной из цепей ДНК часто исправляются ферментами участвующими в BER репарации.
Двуцепочечные разрывы (DSB)
Имеется два механизма которые способны устранить двуцепочечных разрывов ДНК:
Прямое соединение сломаных концов. Этот процесс требует специальных
ферментов, которые узнают и связывают разорванные концы с последующим их сшиванием. Если разорванная ДНК имеет тупые концы и соединение двух фрагментов ДНК происходит случайно, то такая репарация называется NHEJ. Белок Ku необходимый для NHEJ. Ku - гетеродимерная субъединица, состоящая из двух белков Ku70 и Ku80.
Ошибки возникающие при прямом присоединении могут являться причиной транслокаций.
Полинуклеотидлигаза – восстановл. одноцеп. разрывы ДНК

Гомологичная рекомбинация

Гомологичная рекомбинация способна восстанавливать поломанные концы хромосом используя ДНК не поврежденной сестринской хроматиды доступной после удвоения хромосом.
Гены необходимые для гомологичной рекомбинации - BRCA-1 and BRCA-2.

Конверсия гена
Донором нового гена может быть:
гомологичная хромосома (во время мейоза)
систринская хроматида (так же во время мейоза)
дуплицированный ген той же хромосомы (во время митоза)

Исправление ошибок за счет 3’-5’ экзонуклеазной активности полимеразы при репликации (только у прокариот) (мутация E.coli mutD-мутатор-измен. -субъединицы ДНК-пол.III)
Тиминовые димеры, фермент фотолиаза ген-phr (у низших эукариот)
Удаление присоединенных алкильных и метильных групп - O-6-метилгуанинтрансфераза (ген ada)-удаляет О-6-метилгуанин
эксцизионная р. оснований [Е.coli ] [человек | узнавание поврежд. XPA-белком в ассоциации с RPA | привлекается ф-р транскр. TFIIH (P52, Р34, Р44, Р62, XPB-XPD-геликазн. акт-ть) | ERCC1-XPF, XPG – нуклеазы, надрезають ДНК по обе стороны от поврежд. | ДНК-полимераза- и вспомогат. белки RFC и PCNA застраивают брешь]
р. азотистых осн.-гликозилаза удаляет осн.
AP-сайт (апуриновый, апиримидиновый) | AP-эндонуклеаза опознает брешь, разрез. 5’-ДНК
пострепликативная р. (ПРР)
SOS-р. белки соед. с ДНК-полимеразой, доч. ДНК строится напротив поврежд. ДНК

Сокращения.
BER - Base Excision Repair

NER - Nucleotide Excision Repair
MMR - Mismatch Repair
NHEJ - Nonhomologous End-Joining

Мисмэтч репарация

В процессе реплакации, в результате ошибок полимеразы, могут встраиваться некомплиментарные нуклеотиды, что может привести к мутациям в дочерней цепи ДНК. Неспареные основания узнаются ферментами мисмэтч репарации и осуществляют замену ошибочно спаренных нуклеотидов.

Ферменты данной системы обеспечивают гомологичную рекомбинацию, а также задержку клеточного цикла в ответ на повреждения ДНК.
Система репарации ошибочно спаренных нуклеотидов у E. coli, использующая белки MutHLS, распознает и репарирует все некомплементарные пары оснований за исключением C–C. Кроме того, эта система репарирует небольшие вставки в одну из цепей ДНК, образующиеся в результате ошибок репликации, длина которых не превышает четырех нуклеотидов.
Обычно у E. coli ДНК метилирована Dam-метилазойпо сайтам GATC. Однако после завершения репликации дочерняя цепь ДНК некоторое время остается неметилированной.
Эта система может быть реконструирована in vitro с использованием
ДНК с одной метилированной цепью в качестве субстрата, к которой добавляются очищенные белки MutH, MutL, MutS, UvrD (хеликаза II), холофермент ДНК-полимеразы III, ДНК-лигаза, белок SSB, а также одна из экзонуклеаз: ExoI, ExoVII или RecJ. Процесс репарации инициируется внесением одноцепочечного разрыва в неметилированную цепь вблизи частично метилированного сайта GATC с последующим гидролизом цепи ДНК и заполнением образующейся одноцепочечной бреши. При этом белок MutS связывается с ошибочно спаренными нуклеотидами. У белка MutL не обнаружено ферментативной активности, хотя он взаимодействует с MutS и необходим для активации MutH – эндонуклеазы, осуществляющей одноцепочечный разрыв ДНК. Таким образом, комплекс MutS–MutL, собранный на участке ДНК с ошибочно спаренным нуклеотидом, стимулирует эндонуклеазную (никазную) активность MutH. Бесклеточная система не требует присутствия MutH при наличии в ДНК-субстрате одноцепочечного разрыва. MutHLS-система репарации может
использовать частично метилированные последовательности GATC, расположенные выше и ниже поврежденного участка ДНК. При этом в
вырезании ошибочно включенного нуклеотида помимо хеликазы II принимает участие одна из экзонуклеаз: ExoI (3’-экзо), ExoVII (3’- и 5’-экзо) или RecJ (5’-экзо) в зависимости от расположения GATC-сайта по отношению к корректируемому нуклеотиду. Вслед за вырезанием нуклеотида образовавшаяся одноцепочечная брешь заполняется холоферментом ДНК-полимеразы III в присутствии SSB-белка и ДНК-лигазы. Следует подчеркнуть, что использование белка MutH и Dam-метилазы для распознавания дочерней цепи реплицировавшейся ДНК является уникальным свойством грамотрицательных бактерий. У грамположительных бактерий не происходит метилирование цепей ДНК в целях маркировки. Если сайты GATC полностью метилированы, MutHLS-система репарации E. coli изменяет ошибочно спаренные нуклеотиды в обеих цепях ДНК с одинаковой эффективностью.
У E. coli существуют, по крайней мере, еще два специфических
пути репарации ошибочно спаренных нуклеотидов. Система VSP (very short patchrepair pathway) репарирует некомплементарные пары G–T, заменяя их на G–C. Считается, что такие пары образуются в результате дезаминирования 5-метилцитозина в сайтах, где остатки С метилированы Dcm-метилазой. С более низкой эффективностью эта же система заменяет пары G–U на G–C. Другая MutY-зависимая система репарации специфически ликвидирует последствия окислительных повреждений гуанина. Если dGTP окисляется с образованием 8-оксо-dGTP, белок MutT расщепляет последний, предотвращая его включение в ДНК. Если же он все-таки включается напротив остатка С, то Fpg-гликозилаза (MutM) удаляет это модифицированное основание. В том случае, когда 8-оксо-G остается в составе ДНК, в следующем раунде репликации он спаривается с А, и в итоге может произойти трансверсия G–C>T–A. В этом случае белок MutY действует как ДНК-гликозилаза, удаляющая остаток A из некорректной пары, и как AP-лиаза, вносящая одноцепочечный
разрыв по соседству с AP-сайтом. Далее следуют процессы, уже рассмотренные выше в связи с функционированием системы репарации BER. Последовательность реакций с участием MutY также репарирует некомплементарные пары A–G и A–C с образованием соответственно пар C–G и G–C. Репарация ошибочно спаренных оснований у эукариот происходит при
участии комплекса белков, подобного системе MutHLS бактерий. Белок GTBP человека представляет собой гомолог бактериального белка MutS, а у дрожжей в соответствующей роли выступает белок Msh6. Распознавание ошибочно спаренных нуклеотидов у человека осуществляется гетеродимером MSH2–GTBP. Гомологами MutL в клетках S. cerevisiae являются белки MLH1 и PMS2, которые также существуют в виде гетеродимерных комплексов. Мутации в генах, кодирующих эти белки у человека, сопровождаются формированием мутаторного фенотипа и развитием наследственного неполипозного рака кишечника (синдром HNPCC – hereditary nonpolyposis colon cancer).

Прямая репарация

Существуют два основных пути репарации алкилированных оснований: эксцезионная репарация оснований (BER) и прямая репарация поврежденных оснований. При BER DNA-гликозилазы выщепляют цитотоксичные алкилированные основания в DNA на первом шаге с образованием AP-сайта и последующим его процессированием.В случае прямой репарации реализуются два способа: репарация алкилтрасферазами либо окисление алкильной группы, в обоих случаях происходит регенерация неповрежденных оснований. Если протекает репарация алкилтрасферазами (у млекопитающих только O6-алкилгуанин репарируется по этому пути), то O6-алкилгуанинтрансфераза (AGT) переносит метильную или этильную группу с O6-алкилгуанина на один из собственных остатков цистеина. Алкилированный в результате собственной активности белок инактивируется, но может служить регулятором активности своего гена и нескольких других. В отличие от суицидных O6-метилгуанинтрансфераз, направленно деметилирующих высокомутагенное и токсичное
повреждение O6-метилгуанин, AlkB из E. coli и его человеческие аналоги hABH2 и hABH3 окисляет метильные группы 1-метиладенина (1-meA) и 3-метилцитозина (3-meC) в DNA для регенерации немодифицированных оснований аденина и цитозина.

O6-алкилгуанинтрансфераза

O6-алкилгуанинтрансферазная активность обнаружена у большинства организмов и препятствует мутагенному действию O6-алкилгуанина. AGT превращает O6-алкилгуанин в гуанин, перемещая алкильную группу с DNA на реакционный остаток цистеина в белке в ходе необратимой реакции.

Работа AGT по перемещению алкильной руппы с DNA на реакционный остаток цистеина в белке

Такое ковалентное присоединение алкильной группы к остатку цистеина инактивирует фермент. Поэтому AGT - суицидный фермент, который подвергается протеолитической деградации после одной
реакции трансалкилирования. Структурные исследования позволяют обнаружить, что активный центр AGT расположен в объеме фермента на некотором расстоянии от DNA-связывающего участка. Считается, что фермент "работает" по механизму "переворачивания нуклеотида", чтобы плотно сблизить основание субстрата и нуклеофильный активный центр AGT.

Важность AGT в защите млекопитающих от токсического и мутагенного эффектов алкилирующих агентов была продемонстрирована на мышах. Трансгенные мыши с чрезмерной экспрессией AGT проявляют значительно более низкий уровень возникновения опухолей в ответ на действие метилирующего агента - N-метил-N-нитрозомочевины, в то время как мыши с дефицитом AGT оказывались на много более восприимчивы к инициированию опухоли и токсическим эффектам этого агента по сравнению с немутантными мышами. AGT - важный фермент в противоопухолевой терапии так как он препятствует цитотоксическим эффектам противоопухолевых агентов класса хлороэтилнитрозомочевины (CENU), например
BCNU (N,N-бис(2-хлороэтил)N-нитрозомочевина) или темозоломид. Было показано, что количество, в котором присутствует AGT в опухолях, в основном определяет на сколько благоприятным окажется исход противоопухолевой терапии с использованием CENU. CENU первоначально взаимодействует с O6-карбонильной группой гуанина с образованием соединения 4, которое впоследствии преобразуется в N1,O6-этаногуанин 5. Соединение 5 перегруппируется в течение нескольких часов в физиологически активный ICL 6. AGT препятствует образованию 6 при взаимодействии с 4 или 5, возобновляя гуанин или формируя DNA-белковый аддукт 8. Экспериментально получено подтверждение образования аддукта 8, но он был выделен в слишком малом количестве для его детального описания. При биохимическом исследовании этой проблемы был введен N1,O6-этаноксантин
9 как стабильный аналог 5 в DNA. Этаноксантин 9 реагирует с AGT с образованием стабильного DNA-белкового аддукта 7. Этот подход позволил формировать ковалентно связанный AGT-DNA аддукт 10 в большом количестве, который может быть использован для определения структуры AGT связанного с DNA. Взаимовлияние AGT и алкилирующей терапии привело к поиску ингибиторов AGT, которые могут быть использованы в терапии рака в сопряжении с алкилирующими агентами. К настоящему времени созданы ингибиторы, главным образом, производные гуанина с заместителями в O6-позиции. O6-бензилгуанин 2 был обнаружен как типичный ингибитор AGT, с которым сравнивают новые молекулы. Эффективность O6-BzG в усилении цитотоксичности CENU продемонстрирована на моделях животных. Лимитирующим фактором этого терапевтического подхода является токсичность для здоровых органов, частично для костного мозга. Некоторые
группы ученых направлены обойти эту проблему путем генерирования ATG-варианта, устойчивого к ингибированию O6-BzG, что может быть использовано для защиты костного мозга при помощи генного переноса.


Оксидоредуктазы AlkB, hABH2 и hABH3

Еще один путь прямой репарации алкилированных оснований - окисление алкильной группы с регенерацией неповрежденного азотистого основания. Фермент AlkB у Escherichia coli и два человеческих аналога hABH2 и hABH3 направленно деметилируют 1-метиладенин и 3-метилцитозин в DNA. Но в отличие от AGT, эти ферменты обладают субстратной специфичностью, направленной на поверхность пар оснований G:C и A:T. Повреждения 1-алкиладенин
и 3-метилцитозин формируются когда аденин и цитозин находятся в одноцепочечной структуре (в период репликации или транскрипции) и являются субстратами для AlkB, hABH2 и hABH3. Они окисляют метильные группы 1-метиладенина (1-meA) и 3-метилцитозина (3-meC) в DNA для регенерации азотистых оснований аденина и цитозина. Было также показано, что AlkB защищает от токсичного повреждения - аддукта с этильной группой и преобразует 1-этиладенин в аденин в DNA, продуцирующий в результате реакции ацетальдегид. Таким образом репарируются повреждения известного мутагена и канцерогена этиленоксида, эндогенно образующегося в ходе метаболизма этилена, а также широко применяющегося как фумигант для стерилизации. Аддукты с гидроксиэтилом, генерируемые этиленоксидом обнаружены в DNA клетки. Другие малые алкилирующие эпоксиды также задействованы в большом количестве в химическом производстве. Было показано, что AlkB снижает токсические эффекты DNA-повреждающих агентов, генерирующих гидроксиэтильный,
пропильный и гидроксипропильный аддукты. AlkB репарирует алкилированные трифосфаты 1-me-dATP активно, но неэффективно. Предполагалось, что эта способность может снижать уровень встраивания алкилированных трифосфатов при синтезе DNA; к тому же Фрагмент Кленова DNA полимеразы I у E. coli может использовать 1-me-dATP как предшественник для синтеза DNA in vitro. Человеческие ферменты hABH2 и hABH3 также деметилировали 1-метиладениновые остатки в поли(dA), они были неэффективны на коротких субстратах. Таким образом hABH3 обладал очень низкой активностью на тримере d(Tp1-meApT), тогда как у hABH2 активности не было обнаружено.

AlkB и его человеческие аналоги является частью -кетоглутарат/Fe(II)-зависимого суперсемейства диоксигеназ, и в процессе репарации протекает свместно декарбоксилирование -кетоглутарата и окислительное деметилирование поврежденного основания. Повреждения 1-meA и 3-meC формируются в основном в одноцепочечной DNA и предположительно
возникают в репликативной вилке и в активно транскрибируемых генах где они могут заблокировать DNA- и RNA-полимеразы. В действительности AlkB, hABH2 и hABH3 репарируют эти повреждения в одноцепочечной DNA, но также протекает репарация олигонуклеотидов, отожженных с комплементарной цепью после алкилирования. Эффективность репарации 1-метиладенина AlkB не зависит от полинуклеотидной структуры, но необходимо наличие нуклеотид-5'-фосфатной группы. Также человеческие ферменты hABH2 и hABH3 деметилировали остатки 1-метиладенина в поли(dA), они были неэффективны на коротких субстратах. К тому же, повреждения, содержащие положительный заряд (рибонуклеозиды 1-meA и 3-meC имеют соответственно pKa= 9.3 и 9.6) лучше репарировались, чем незаряженные основания (1-meG и 3-meT). Однако, так как 1-meG (и в меньшей степени 3-meT) репарировались AlkB, то формальный положительный заряд основания не является необходимым условием для функционирования AlkB. С этой точки зрения
пока неясно, зависит ли этот результат от того, что положительно заряженные основания лучше распознаются посредством электростатических взаимодействий с AlkB или положительно заряженные основания просто делают DNA лучшей уходящей группой после гидроксилирования метильной группы.

Сокращения:

  • AGT - алкилгуанин трансфераза
  • BER - эксцезионная репарация оснований
  • DNA - дезоксирибонуклеиновая кислота
  • RNA - рибонуклеиновая кислота
  • BCNU - N,N-бис(2-хлороэтил)N-нитрозомочевина
  • CENU - хлороэтилнитрозомочевина
  • O6-BzG - O6-бензилгуанин
  • 1-meA - 1-метиладенин
  • 1-meG - 1-метилгуанин
  • 3-meC - 3-метилцитозин
  • 3-meT - 3-метилтимин

Литература: 

» Orlando D. Scharer (2003) Angew. Chem. Int. Ed. 42, 2946-2974
» James C. Delaney and John M. Essigmann Mutagenesis, genotoxicity, and repair of 1-methyladenine, 3-alkylcytosines, 1-methylguanine, and 3-methylthymine in alkB Escherichia coli
» Pertti Koivisto, Tod Duncan, Tomas Lindahl, and Barbara Sedgwick Minimal Methylated Substrate and Extended Substrate Range of Escherichia coli AlkB Protein, a 1-Methyladenine-DNA Dioxygenase*
» Duncan, T., Trewick, S. C., Koivisto, P., Bates, P. A., Lindahl, T. & Sedgwick, B. (2002) Proc. Natl. Acad. Sci. USA 99, 16660-16665. 5. Aas, P. A., Otterlei, M., Falnes, P. O., Vagbo, C. B., Skorpen, F., Akbari, M., Sundheim, O., Bjoras, M., Slupphaug, G., Seeberg, E., et al. (2003) Nature 421, 859-863.
» Hollis, T., Lau, A., and Ellenberger, T. (2000) Mutat. Res. 460, 201-210
» Daniels, D. S., and Tainer, J. A. (2000) Mutat. Res. 460, 151-163
» Trewick, S. C., Henshaw, T. F., Hausinger, R. P., Lindahl, T., and Sedgwick, B. (2002) Nature 419, 174-178
» Falnes, P. O., Johansen, R. F., and Seeberg, E. (2002) Nature 419, 178-181
» Duncan, T., Trewick, S. C., Koivisto, P., Bates, P. A., Lindahl, T., and Sedgwick, B. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 16660-16665
» Aas, P. A., Otterlei, M., Falnes, P. O., Vagbo, C. B., Skorpen, F., Akbari, M., Sundheim, O., Bjoras, M., Slupphaug, G., Seeberg, E., and Krokan, H. E. (2003) Nature 421, 859-863
» Aravind, L., and Koonin, E. V. (2001) Genome Biology 2, 0007.1-0007.8
» Bodell, W. J., and Singer, B. (1979) Biochemistry 18, 2860-2863
» Boiteux, S., and Laval, J. (1982) Biochimie (Paris) 64, 637-641
» Larson, K., Sahm, J., Shenkar, R., and Strauss, B. (1985) Mutat. Res. 150, 77-84
» Dinglay, S., Trewick, S. C., Lindahl, T., and Sedgwick, B. (2000) Genes Dev. 14, 2097-2105

Репарация разрывов ДНК

Фотореактивация

Абсорбция энергии УФ излучения молекулами ДНК приводит к образованию различных типов повреждений. Хотя одно- и двуцепочечные разрывы, а также ДНК-белковые сшивки могут возникать, большая часть индуцированных УФ-излучением повреждений приходится на модификацию азотистых оснований, с образованием циклобутан пиримидиновых димеров (CPD) и пиримидин-пиримидоновых фотопродуктов (6-4PP), как наиболее часто встречающихся типов фотоповреждений.

Пиримидиновые димеры являются ингибиторами и для репликации, и для транскрипции, что замедляет рост и приводит к мутагенезу в процессе репликации ДНК, если такие повреждения остаются неотрепарированными.

Для удаления индуцированных светом повреждений в ДНК у многих организмов применяются ферменты, специфично связывающиеся с CPD (CPD-фотолиаза) или с 6-4PP (6-4PP-фотолиазы) и исправляющие эти повреждения. CPD-фотолиазы обнаружены в бактериях, грибах, растениях, беспозвоночных и во многих позвоночных, 6-4PP-фотолиазы обнаружены, пока, только в Drosophila, тутовом шелкопряде, Xenopus laevis и в гремучих змеях, но не у Escherichia coli или дрожжей. У людей не обнаружено фотолиаз. Фотолиазы содержат FAD как каталитический кофактор и дополнительный хромофор в качестве светособирающей антенны.

Дополнительные хромофоры – это или 5,10-метенилтетрагидрофолат (MTHF), или 8-гидрокси-5-деазорибофлавин (8-HDF), с максимумами поглощений на длинах волн 380 и 440 нм, соответственно. Кристаллические структуры CPD-фотолиаз E.coli и Anacystis nidulans подтверждают, что для связывания с ДНК ферменты поворачивают пиримидиновый димер из дуплекса в углубление, содержащее каталитический кофактор. Затем циклобутановое кольцо расщепляется в ходе переноса, индуцированного светом электрона. CPD-фотолиазы селективно распознают CPD, подобно ДНК-связывающим белкам. Белый свет или UV-B-излучение индуцируют экспрессию CPD-фотолиаз. В отличие от CPD-фотолиаз, 6-4PP-фотолиаза стабильно экспрессируется и не регулируется ни белым светом, ни UV-B-излучением.

Схематичное изображение фотореактивации в хроматине. Октамеры гитонов голубого цвета, ДНК - черного. Фотолиаза связывается с циклобутан-пиримидиновыми димерами (CPD), поворачивает пиримидиновый димер и регенерирует природные пиримидины в ходе, зависимой от освещения, реакции. Фотолиаза предпочтительно репарирует CPD в линкетной ДНК. Репарация в нуклеосомах замедлена и, предположительно, облегчается динамическими свойствами нуклеосом, перемещающих повреждения ДНК в область линкерной ДНК.

Класс CDP-специфичных фотолиаз из микроорганизмов, определенный как класс I фотолиаз, был первым охарактеризованным представителем семейства фотолиаз. Близкородственный класс фотолиаз специфичных к 6-4-фотопродуктам был обнаружен недавно, представители этого семейства были найдены в Drosophila melanogaster, Xenopus laevis и Arabidopsis thaliana. Криптохромы, являющиеся фоторецепторами на фиолетовую часть светового спектра обнаруженные в растениях и других организмах, также являются близкородственными классу I фотолиаз.

Более дальнородственным семейством CPD-фотолиаз, названное классом II фотолиаз было идентифицировано в ряде видов, включая животных, Archaebacterium, Eubacterium и высших растений. Было показано, что все охарактеризованные фотолиазы содержат восстановленный FAD и большинство содержат вторичные хромофоры в зависимости от вида либо MTHF, либо 8-HDF. Подобный механизм реакции был предложен для обоих классов CPD-фотолиаз. Хромофор MTHF или 8-HDF подобен антенне, которая абсорбирует фиолетовый свет и расходует поглощенную энергию на регенерацию FADH-.

Состав кофактора растительной фотолиазы не до конца исследован, хотя, недавно было показано, что CPD-фотолиазы из Arabidopsis содержавшие только FADH обладали ферментативной активностью.

Литература: 

» Fritz Thoma, Light and dark in chromatin repair: repair of UV-induced DNA lesions by photolyase and nucleotide excision repair, Institut fur Zellbiologie, ETH-Zurich, Honggerberg, CH-8093 Zurich, Switzerland
» Characterization of Arabidopsis photolyase enzymes and analysis of their role in protection from ultraviolet-B radiation, Wanda M. Waterworth 1, Qing Jiang, Christopher E. West, M. Nikaido and Clifford M. Bray

Эксцизионная репарация

Репликация

репликация эукариот

Общие сведения

Репликация у прокариот

Репликацию ДНК удобнее всего рассматривать на бактерии E.coli, как на наиболее изученном прокариотическом организме.
Направление движения вилки репликацииНаправление движения вилки репликации

Репликация происходит одновременно в двух направлениях от места начала репликации. Обе цепи синтезируются холоэнзим ДНК-полимеразой III. Одна из альфа субъединиц холоэнзима синтезирует лидирующую, тогда как другая альфа субъединица синтезирует отстающие цепи, называемые фрагментами Оказаки, имеющие 10 РНК нуклеотидов на 5' конце (РНК-праймер) и около 1000 нуклеотидов ДНК. РНК-праймер удаляется ДНК-полимеразой I и фрагменты сшиваются друг с другом ДНК лигазой.

ДНК-полимеразы E.coil

У E.coli имеется пять различных ДНК-полимераз.

Pol I

pol I представлена одним полипептидом с тремя активностями:

  • полимеразная - катализирует перенос нуклеотидов к 3'-концу праймера ДНК или РНК и спаривание комплементарного нуклеотида
  • 3'-5'-экзонуклеазная - удаляет 3'-концевые ошибочно встроенные нуклеотиды, препятствуя образованию мутаций
  • 5'-3'-экзонуклеазная - удаляет 5'-концевые нуклеотиды

Способность ДНК-полимеразы удлинять 3'-конец цепи, спаренной с матричной цепью, позволяет ей заполнять пробелы между сегментами отстаю- щей цепи. Pol I удлиняет фрагменты Оказаки с 3'-концов и удаляет рибонуклеотиды, с которых начинаются 5'-концы соседних фрагментов, что является необходимой предпосылкой для формирования непрерывной отстающей цепи. Поскольку Pol I способна удлинять 3'-конец одной из цепей в месте разрыва в двухцепочечной ДНК и удалять нуклеотиды с 5'-конца того же разрыва (процесс, называемый ник-трансляцией). этот фермент играет ключевую роль в репарации поврежденной ДНК

Трипсин расщепляет Pol I на два фрагмента: большой C-концевой «фрагмент Кленова» (ДНК-полимераза, 3'-5'-экзонуклеаза) и малый N-концевой (5'-3'-экзонуклеаза).

Pol II

Pol II присоединяет нуклеотиды значительно менее эффективно, чем Pol I, и не обладает 5'-3'-экзонуклеазной активностью. Следовательно, Pol II может заполнять пробелы между фрагментами ДНК, спаренными с матричной цепью, но не спо- собна отщеплять РНК-нуклеотиды от фрагментов Оказаки или осуществлять ник-трансляцию. присутствуют в клетке в меньших количествах.

Pol III

Pol III-холофермент – это ключевой фермент, ответственный за репликацию хромосомной ДНК E. coli. В каждой клетке содержится только 10–20 копий Pol III-холофермента, и тем не менее он является основным компонентом мультиферментного комплекса, инициирующего формирование репликативных вилок в точках начала репликации, Но поскольку Pol III-xoлофермент не обладает 5'-3'-экзонуклеазной активностью, для репликации отстающей цепи необходимо участие Pol I, чтобы произошло удлинение продукта, образовавшегося при участии Pol III, и удаление РНК-праймеров на 5'-конце фрагментов Оказаки.

?-субъединица обладает полимеразной активностью, а ?-субъединица -3'-5'-экзонуклеазной. Однако комплекс ?- и ?-субъединиц обладает значительно более высокой полимеразной и экзонуклеазной активностями, чем каждая из соответствующих субъединиц в отдельности. Функция третьей, ?-субъединицы пока неясна.

Помимо субъединиц, составляющих Pol III-кор, Pol III-холофермент содержит еще семь субъединиц: ?, ?, ?, ?, ?', ? и ?. Перечисленные полипептиды также существуют во множестве копий, так что в результате молекулярная масса комплекса составляет примерно 103 кДа. Роль ?-субъединицы заключается в том, чтобы свести к минимуму вероятность отделения фермента от матрицы до завершения процесса копирования; точная же функция других субъединиц неизвестна.

Pol III-холофермент существует в двух формах, каждая из которых содержит определенный набор вспомогательных субъединиц, придающих ферменту определенные свойства. В одной форме фермент катализирует синтез непрерывной ведущей цепи, а в другой – прерывистой отстающей.

Pol III-холофермент катализирует те же реакции синтеза, что и Pol I, но работает примерно в 60 раз быстрее. Более того, Pol III-холофермент обладает повышенным сродством к матрице и обеспечивает более высокую эффективность копирования.

Pol III-холофермент может связываться и с другими белками, увеличивая эффективность процесса копирования благодаря координации некоторых важных ферментативных этапов репликации.

На этом более высоком уровне организации в комплексы могут включаться белки, расплетающие спираль ДНК в точках начала репликации и в репликативных вилках (расплетазы или геликазы), инициирующие образование праймерных РНК праймазы), обеспечивающие последовательное наращивание цепей ДНК, терминирующие процесс репликации и разделяющие дочерние спирали ДНК

Инициация репликации на oriC

Синтез лидирующей цепи ДНК

Синтез отстающей цепи ДНК

Созревание фрагментов Оказаки

Терминация ДНК-репликации

Окончание репликации ter (terminus) находятся на противоположной стороне от ориджина кольцевой хромосомы E. coli. Ter сайты работают как ловушки: репликационная вилка попадает и не выходит из этой области в 450 тысяч пн. Имеется 6 ter сайтов терминации. Белок Tus связывается с ter сайтами и останавливает гиликазу DnaB. Синтез ведущей цепи ДНК останавливается в 1 нуклеотиде от места связывания белка Tus. Ter сайты работают только в одном направлении. Для каждого раунда репликации, только один сайт терминации обычно используется. Остановившаяся на сайте терминации вилка ждет другую вилку, которая придет с другой стороны.

Расхождение дочерних кольцевых молекул ДНК

Для разделения дочерних кольцевых молекул ДНК требуется действие топоизомераз. Топоизомераза IV (parC и parD) выполняет эту функцию. Работает совместно с топоизомеразой II (gyrase, gyrA и gyrB).